ID: 1041752618

View in Genome Browser
Species Human (GRCh38)
Location 8:61277460-61277482
Sequence TGTCTTTGTCCTGCATTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 216}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041752618_1041752626 17 Left 1041752618 8:61277460-61277482 CCCAGTAATGCAGGACAAAGACA 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1041752626 8:61277500-61277522 GATGGTCTATGGGTGAGTATAGG No data
1041752618_1041752624 6 Left 1041752618 8:61277460-61277482 CCCAGTAATGCAGGACAAAGACA 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1041752624 8:61277489-61277511 AAGACAGAAGGGATGGTCTATGG No data
1041752618_1041752625 7 Left 1041752618 8:61277460-61277482 CCCAGTAATGCAGGACAAAGACA 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1041752625 8:61277490-61277512 AGACAGAAGGGATGGTCTATGGG No data
1041752618_1041752621 -6 Left 1041752618 8:61277460-61277482 CCCAGTAATGCAGGACAAAGACA 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1041752621 8:61277477-61277499 AAGACACAGGTGAAGACAGAAGG No data
1041752618_1041752623 -1 Left 1041752618 8:61277460-61277482 CCCAGTAATGCAGGACAAAGACA 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1041752623 8:61277482-61277504 ACAGGTGAAGACAGAAGGGATGG No data
1041752618_1041752628 19 Left 1041752618 8:61277460-61277482 CCCAGTAATGCAGGACAAAGACA 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1041752628 8:61277502-61277524 TGGTCTATGGGTGAGTATAGGGG No data
1041752618_1041752627 18 Left 1041752618 8:61277460-61277482 CCCAGTAATGCAGGACAAAGACA 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1041752627 8:61277501-61277523 ATGGTCTATGGGTGAGTATAGGG No data
1041752618_1041752622 -5 Left 1041752618 8:61277460-61277482 CCCAGTAATGCAGGACAAAGACA 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1041752622 8:61277478-61277500 AGACACAGGTGAAGACAGAAGGG No data
1041752618_1041752629 22 Left 1041752618 8:61277460-61277482 CCCAGTAATGCAGGACAAAGACA 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1041752629 8:61277505-61277527 TCTATGGGTGAGTATAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041752618 Original CRISPR TGTCTTTGTCCTGCATTACT GGG (reversed) Intronic
901220287 1:7579906-7579928 TGTCCTTCTCCTGCGTCACTGGG + Intronic
902832686 1:19028047-19028069 TTTTTTTTTCCTGCTTTACTGGG - Intergenic
903093902 1:20950515-20950537 TCTGTTTGTCCTGCTTTGCTAGG - Intronic
905098695 1:35498942-35498964 GGTCTTCTTCCTGCATTAGTGGG + Intronic
906339503 1:44966504-44966526 TGTCTTTGTCCTGCTTAATTTGG - Intronic
907161835 1:52376519-52376541 TGTTTGTGTCCTGGGTTACTTGG - Intronic
908323647 1:63002299-63002321 TCTATTTGTCCTTCATGACTGGG - Intergenic
908407084 1:63825752-63825774 TTTCTTTATCCTGGATGACTTGG + Intronic
908997480 1:70173827-70173849 TGTTTTAGGTCTGCATTACTTGG - Intronic
909237949 1:73177196-73177218 GGTCTTTGTCCTGGGTTCCTGGG - Intergenic
909688148 1:78374461-78374483 TGTCTTAGCCCAGTATTACTGGG - Intronic
911181010 1:94860427-94860449 TTTCTTTGTTCTGTATTTCTGGG - Intronic
911619443 1:100050307-100050329 TGTCTGTGACCTGCATGACTCGG + Intronic
912176334 1:107162206-107162228 TGTCTTTGGGGTGCATTCCTTGG - Intronic
913009393 1:114668556-114668578 TGTCTTGGTCTTTCATTAGTTGG - Intronic
913560557 1:120014742-120014764 TTTTTCTGTCCTGTATTACTAGG - Intronic
913637569 1:120778860-120778882 TTTTTCTGTCCTGTATTACTAGG + Intergenic
914328440 1:146643772-146643794 TGAGTTTGTCCTGCCTTCCTGGG + Intergenic
914542187 1:148625090-148625112 TTTTTCTGTCCTGTATTACTAGG - Intronic
914624452 1:149446153-149446175 TTTTTCTGTCCTGTATTACTAGG + Intergenic
915079749 1:153344067-153344089 TGTCTTTGTCGTGCTTATCTGGG - Intronic
916474020 1:165151162-165151184 TTTCTTTGTCCTTCATGATTTGG + Intergenic
917159109 1:172037445-172037467 TTTCTTTTTTCTGCATTTCTAGG + Intronic
920145008 1:203852537-203852559 TGTATGTGTCCTGGATTCCTTGG + Exonic
920823272 1:209401178-209401200 GGCCTTTGTCCTGCGTTCCTGGG - Intergenic
920951223 1:210573429-210573451 GGCCTTTGTGCTGGATTACTTGG - Intronic
921707216 1:218336725-218336747 TGTCTTTGTACAGCAACACTGGG + Exonic
921820299 1:219609468-219609490 TGTATGTGTCCTGGATTCCTTGG - Intergenic
924406265 1:243750478-243750500 TGCCTTTGTCCTCCACTTCTGGG + Intronic
1063915428 10:10877398-10877420 TCTCGTTGTCCTGCCTTTCTGGG - Intergenic
1064428959 10:15255014-15255036 TCTCTGTGTCCTGCATGAATGGG - Intronic
1065108198 10:22412179-22412201 TGCCTTTATCCTGCATGCCTTGG - Intronic
1069864623 10:71494321-71494343 TGTCTATGTCTTGGATAACTGGG + Intronic
1070457963 10:76635838-76635860 TTTCTTTGTCCTGGAAAACTTGG - Intergenic
1071737583 10:88318603-88318625 TGTCTGTGTCCTCCATTGCCAGG - Intronic
1073039263 10:100589521-100589543 TTTCTTTTTCCTGCCTTTCTGGG - Intergenic
1073910963 10:108343864-108343886 TGTCTTTATCCTCCCTCACTTGG - Intergenic
1074635775 10:115315589-115315611 TGTCCTCTTCCTGTATTACTAGG - Exonic
1074835637 10:117290391-117290413 TGTTTTTTTCCTCTATTACTAGG - Intronic
1075832430 10:125422821-125422843 TGTGTTTGTCCGGCATTCCTTGG - Intergenic
1077656770 11:4027152-4027174 GATCTTTGTCCTGGGTTACTGGG - Intronic
1078221885 11:9358158-9358180 TGTCTTTGTCCTGATTGGCTAGG - Intergenic
1079422922 11:20311232-20311254 TGTATTAGTCCTCCATCACTAGG - Intergenic
1079893882 11:26094095-26094117 TGTATATGTCCAGCATTATTTGG - Intergenic
1079943244 11:26708834-26708856 TGTTTTTGTCTTGTATTTCTGGG - Intronic
1080186663 11:29495787-29495809 TGTCTGTGTTCTACATCACTGGG - Intergenic
1081156649 11:39701493-39701515 TTTCTTTGTCTTGCATAACATGG + Intergenic
1081242555 11:40725021-40725043 TAGCTTTCTCCTGCATTACATGG - Intronic
1081641712 11:44760191-44760213 TGTCTGTCTCCTGCTTTAGTGGG - Intronic
1081887160 11:46507765-46507787 TGTCTTCGTTCTGAAATACTTGG - Intronic
1083439566 11:62666799-62666821 TGCCTTTGTCCAGCAGTAGTTGG - Exonic
1083545732 11:63547624-63547646 TGTGTTTGACCTCCATGACTAGG + Intergenic
1084633652 11:70374835-70374857 AATCTTTCTCCTGCATTACAGGG + Intronic
1085309737 11:75509098-75509120 TCTCTGTGTCCTGCATCCCTGGG - Intronic
1087821980 11:102722664-102722686 TGTCTTTGTCCAGGACTACCTGG - Exonic
1089243662 11:117102144-117102166 TGCCTTTGTCTTGCATTACAGGG - Intergenic
1091178253 11:133580720-133580742 TGTCTTAGTCCTGCTTGACCTGG + Intergenic
1091924757 12:4336434-4336456 TGTGTGTGTGCTGCATTGCTGGG - Intronic
1093114163 12:15189036-15189058 TATGTTTGCCCTGCCTTACTTGG + Intronic
1096810123 12:54164083-54164105 TGTCTTGCTCTTGCATTCCTGGG - Intergenic
1097105903 12:56624274-56624296 TATCTTTGTTCTGCCTCACTTGG - Intronic
1099180880 12:79471927-79471949 TGTCTATGCCCTGCAATATTGGG - Intergenic
1099877498 12:88427301-88427323 GATCATTGTTCTGCATTACTTGG - Intergenic
1100126770 12:91436598-91436620 TGTCTTTGTCCAGGATTCCTGGG + Intergenic
1102591159 12:113957850-113957872 TGTCTCTTTCCTGCAGGACTGGG + Exonic
1106869192 13:34000527-34000549 TGCTTTTCTCCTGAATTACTTGG + Intergenic
1107167854 13:37303754-37303776 TCTCTTTCTCCTTCATTACCAGG - Intergenic
1107687087 13:42912918-42912940 TGTCTTTGCTCTCCATTTCTGGG - Intronic
1107765756 13:43732835-43732857 TTGCTTTGTCTTGCATTACTGGG - Intronic
1108816702 13:54301427-54301449 AGTCTTTGTGCTGCATTGCCTGG + Intergenic
1109739987 13:66540805-66540827 TGACTTTGTCCTTAATTATTTGG + Intronic
1109837945 13:67883312-67883334 TGTATTTCTCCTCTATTACTAGG + Intergenic
1110052033 13:70914605-70914627 TCTCTTTGTCCTGCTTCTCTGGG + Intergenic
1110207109 13:72927866-72927888 TGTGTTTGTACTACATTAGTGGG + Intronic
1113633254 13:111902092-111902114 GGTCTTTGTCCTGGGTTCCTAGG - Intergenic
1113894814 13:113757121-113757143 TTTCTGTGGCCTGCATTACCTGG + Intergenic
1115458260 14:33630491-33630513 TGTATTTGTATTTCATTACTTGG - Intronic
1115468713 14:33745398-33745420 GGACTTAGTCCTGCATTCCTGGG + Intronic
1116241895 14:42354292-42354314 TCTCTTTGTCCTACATTACCTGG + Intergenic
1117457622 14:55913702-55913724 TGGCTTTATCCTGGACTACTGGG + Intergenic
1117788348 14:59311366-59311388 TGTCTCTGTCCTCCACTCCTGGG - Intronic
1126478217 15:49089619-49089641 GTTCTTTGTCCTACATTATTAGG - Intergenic
1130580091 15:85129222-85129244 TGTCTTTGTCTGGCTTTATTAGG + Intronic
1131040313 15:89258800-89258822 TGTCTGTCTCCTGCATTCATTGG + Intronic
1132930702 16:2457689-2457711 TCTCTTTGTGCTGAATTTCTGGG + Exonic
1134836186 16:17363221-17363243 CATCTTTGTCCTGCACTACTAGG - Intronic
1135731916 16:24901761-24901783 TGTCTTTGTCCTCCACCACTAGG - Intronic
1138107804 16:54299404-54299426 TGTATTTGTCATCCATTGCTAGG - Intergenic
1138119591 16:54388625-54388647 TGTCTTTGAGCTGCTTTTCTGGG + Intergenic
1140005124 16:71067170-71067192 TGAGTTTGTCCTGCCTTCCTGGG - Intronic
1140192332 16:72828658-72828680 GGTCTTTGTCCTGCATTTGGGGG - Intronic
1140203488 16:72913818-72913840 TGTCTTTGTTTTGCATACCTGGG + Intronic
1141865930 16:86749758-86749780 TGCCTTTTTCCTGGAGTACTAGG - Intergenic
1143266958 17:5645360-5645382 TGTCTTTTTCCTGATTTAATTGG + Intergenic
1143428947 17:6865131-6865153 TCTCTTTGTCCTTTATTACCTGG + Intergenic
1144229593 17:13188276-13188298 TGTCTCTGACTTGCATTTCTAGG - Intergenic
1146001352 17:29132430-29132452 TGTCTTTTTCCTGTAGTCCTAGG - Intronic
1146645393 17:34573820-34573842 TGTCTCTGTCCTTCAGGACTTGG + Intergenic
1146992197 17:37284927-37284949 TGTCTCGGCCCTGCTTTACTAGG + Exonic
1148269047 17:46249433-46249455 AGTCCTTGTCCTGCTTGACTTGG + Intergenic
1152551522 17:81032746-81032768 TGCCCTTGTTCTGCATTCCTAGG + Intergenic
1156398487 18:36720167-36720189 TGTCTGTGTCCTGACTTTCTAGG + Intronic
1156411266 18:36829622-36829644 TGTCTTTAGTCTGCATTGCTAGG + Intronic
1157452206 18:47797251-47797273 AGGCTCTGTCCTGCTTTACTGGG + Intergenic
1158361508 18:56678933-56678955 TGTCTCTGTTATGAATTACTTGG + Intronic
1159254591 18:65930308-65930330 TGTCTTTTTCCTTCATTCTTCGG - Intergenic
1163624139 19:18378934-18378956 TGTGGTTCTCCTGCAATACTTGG - Intronic
1166252947 19:41584148-41584170 TGTCTTAGGCTTGAATTACTGGG - Intronic
1167377171 19:49118472-49118494 TGTGTCTGTCCTGCATCCCTGGG + Exonic
1167687575 19:50966248-50966270 TGTATTTGTCCTGAACAACTGGG - Intronic
925514932 2:4671185-4671207 TTTCTCTCTCCTTCATTACTGGG - Intergenic
926531536 2:14052469-14052491 TTTCTTTGTACTGCCTTTCTCGG - Intergenic
928059128 2:28092149-28092171 TGCCTTTTTCCTGATTTACTTGG - Intronic
928869288 2:35957968-35957990 TCTCCTTTTCCTGCTTTACTTGG - Intergenic
928937078 2:36689505-36689527 GGTCTTTGTCTTTCATGACTTGG + Intergenic
929655311 2:43725226-43725248 TTTCTTTGTCCTGCTTATCTGGG + Intronic
930592813 2:53349536-53349558 TGTGTTTGGCCTGCATTACCAGG - Intergenic
932425034 2:71626594-71626616 TATCTTTTTTCTGCATTGCTGGG + Intronic
933638730 2:84736286-84736308 TGGCTTTGTCCTTTTTTACTAGG + Intronic
935673211 2:105572787-105572809 TGTCATTGGCCTGCATTTCGGGG + Intergenic
936343070 2:111654718-111654740 TGTCCTTGTCTTGCATTTTTTGG - Intergenic
937736701 2:125299324-125299346 TGTCTCTGTTTTGCATAACTTGG + Intergenic
938954628 2:136286430-136286452 AGTCATTGTCCTGCAGTTCTAGG + Intergenic
941301002 2:163801235-163801257 TGCATTTGTCCTGCTTTAATGGG + Intergenic
941846822 2:170141883-170141905 TCTTTCTGTCCTGCATTAATTGG + Intergenic
946370256 2:219277250-219277272 TGTCATTGTCTTTCATTAGTTGG + Intronic
947795174 2:232890036-232890058 GGTCTCTGTCCTGCCTCACTGGG + Intronic
947795212 2:232890189-232890211 GGTCTCTGTCCTGCCTCACTGGG + Intronic
947795223 2:232890228-232890250 GGTCTCTGTCCTGCCTCACTGGG + Intronic
1168890368 20:1291943-1291965 CTTCTTTCTCCTTCATTACTAGG - Intronic
1169182899 20:3585862-3585884 TGGCTTTGACTTGCATTTCTTGG - Intronic
1170099488 20:12682949-12682971 TGTGTTTGTCCTGCAGAAATAGG - Intergenic
1170162062 20:13323218-13323240 TGTGTTTCTCCTGCTTTACAAGG - Intergenic
1174947905 20:55008965-55008987 TGTCTTTGTCTTAAATTGCTAGG + Intergenic
1176923250 21:14715571-14715593 TGTGTTTTTCCTTCATTCCTGGG - Intergenic
1176924065 21:14725084-14725106 TTGCTTTATCCTGCATTACCCGG - Intergenic
1177376105 21:20272885-20272907 TGTCTTTGTTTAGCATAACTGGG + Intergenic
1179909249 21:44439207-44439229 TGTGTTTGTCCTGCAGCCCTGGG - Intronic
1180752298 22:18132817-18132839 TGTTTCTGTCCTGTATTCCTTGG + Intronic
1182403108 22:30098626-30098648 TGTTTTAGTCTTGAATTACTTGG + Intronic
1185040674 22:48502383-48502405 TGCCTTGGTGCTGCATTTCTGGG + Intronic
949678013 3:6479846-6479868 ATTCTTTGTACTGCATTAATTGG - Intergenic
950364861 3:12475750-12475772 GGTCTTGGTCCTGCCTTCCTTGG - Intergenic
951392287 3:22121237-22121259 TGTCTTTGTGCTTCAGTGCTTGG - Intronic
952715643 3:36477579-36477601 TGTCTTTGTGCTCCAATATTTGG + Intronic
956171364 3:66436180-66436202 TGTCTTCTTCCAGCACTACTTGG + Intronic
956722951 3:72134244-72134266 TGTCTTTGTCCTACACAGCTGGG + Intergenic
958067334 3:88560233-88560255 TTTCTTTGTCGTGATTTACTTGG + Intergenic
958170546 3:89934014-89934036 TTTCTTTGTTCTGCATGCCTGGG + Intergenic
961953704 3:130777703-130777725 TGTGTTTGTCCTGTTTCACTTGG - Intergenic
964636461 3:158862726-158862748 GCTCTTTGTCCTGCATTATGTGG - Intergenic
966587302 3:181641496-181641518 TTTTTTTTTTCTGCATTACTGGG - Intergenic
967218008 3:187226540-187226562 TCTCATCGTCCTGCACTACTGGG + Intronic
967329136 3:188273108-188273130 TGTTTTTATCCTGCTTTACTGGG - Intronic
967871981 3:194237440-194237462 TGTAGTTGTCCTGCAGTTCTTGG - Intergenic
969844398 4:9908733-9908755 TGATGTTCTCCTGCATTACTGGG + Intronic
970704024 4:18778275-18778297 CTTCTTTGACCTGCATTAGTGGG + Intergenic
973234002 4:47876898-47876920 TGTCTTTGATCTGCACAACTGGG + Intronic
973551424 4:52038846-52038868 TGTTTTTATCCTGCGATACTGGG + Intergenic
974334064 4:60517232-60517254 TGTTTTTTTCCTGCATTAATAGG - Intergenic
980173602 4:129318626-129318648 TGTCTATTTCCTGCATTTTTTGG + Intergenic
981754344 4:148124784-148124806 TCTCTCTGTACTGCATTCCTAGG + Intronic
987380614 5:17282314-17282336 AGTCTTTCTCCTGCATTAAGAGG - Intergenic
987455054 5:18133923-18133945 TCTCTTTGTCTTGTATTTCTGGG + Intergenic
988076981 5:26365581-26365603 TGTCTCAGTTCTGCATGACTGGG - Intergenic
995355354 5:111230948-111230970 CCTCTTTGTCCTGAATTACATGG - Intronic
995595003 5:113738604-113738626 TGTCTTGGTCCAGCCTCACTTGG + Intergenic
995625254 5:114069278-114069300 TGACTTAGTCTTGCTTTACTGGG + Intergenic
995995486 5:118293142-118293164 TGACTTTGTTCTGCATGGCTGGG - Intergenic
997642178 5:135456461-135456483 TGCCTGTGTCCTTCATAACTTGG + Intergenic
997744086 5:136283568-136283590 TCTCTTTATCCTGCCTTAGTGGG - Intronic
998060338 5:139114116-139114138 TGGCTTTGGCCTTCATTACCCGG - Intronic
999515766 5:152300044-152300066 TATCTTTGACCTGAATTTCTGGG - Intergenic
1000169266 5:158685815-158685837 TTTCTGTCTCCTGGATTACTTGG + Intergenic
1000345435 5:160310375-160310397 TGTCTTTGTCCTGCGTTGCTTGG - Intronic
1000913912 5:167056981-167057003 TGTATGTGTCCTGCAGTTCTTGG + Intergenic
1001156480 5:169276736-169276758 TGTTTTTGTCAAGCCTTACTGGG - Intronic
1005192185 6:23237418-23237440 TGTAATTGTCCTACAGTACTTGG + Intergenic
1006368060 6:33627629-33627651 TGTCTTTGATCTCCATTTCTGGG - Intronic
1007246795 6:40469051-40469073 TGTGATTGTCCTGGATTACCCGG + Intronic
1009565338 6:65305094-65305116 TGTATGTGTCCTGGATTCCTTGG + Intronic
1011585851 6:88924189-88924211 GGACTTTGCCCTGCATTACCTGG - Intronic
1012956257 6:105573637-105573659 TGTCTTTGTCCACAAATACTGGG - Intergenic
1014031824 6:116714779-116714801 TGCCTTTGTTTTGCATAACTGGG - Intronic
1014959114 6:127660327-127660349 TATCCTTGTCCTGCTTTATTAGG - Intergenic
1015286777 6:131494546-131494568 GGTCTCTCTCCTGCATTACAAGG + Intergenic
1017105168 6:150880487-150880509 TTTCTTTATCCTCCATTAATGGG + Intronic
1021511429 7:21436971-21436993 TGTCTTTCTACTGCATTTTTGGG + Intronic
1021630820 7:22645720-22645742 TGTCTCTGTCATGACTTACTTGG + Intergenic
1023367859 7:39482572-39482594 TGTCATTGTCCTACAGTTCTTGG + Intronic
1023386784 7:39666110-39666132 TTTCTTTTTCCTGCTTTCCTTGG + Intronic
1025565856 7:62433218-62433240 TGTCTTTTTCCTTCCTTCCTTGG - Intergenic
1026646579 7:72176034-72176056 TGTCTTTGTCTTGCTTATCTGGG - Intronic
1030000628 7:105056517-105056539 TGTCTTCCTCCAGCATTACTGGG + Intronic
1030419570 7:109290887-109290909 TGTCTTTCTGTTACATTACTTGG + Intergenic
1030920857 7:115384401-115384423 TGTAATTGTCCTACATTACAAGG + Intergenic
1031116302 7:117672780-117672802 TGTATTTGTCTTGCATTTGTAGG - Intronic
1031639250 7:124141577-124141599 TTTTTTTCTGCTGCATTACTAGG + Intergenic
1033294743 7:140121687-140121709 TGAAATTGTCCTGCATCACTCGG + Intronic
1035994244 8:4528164-4528186 TGTTTTTGACCTGTATTCCTTGG + Intronic
1037500823 8:19484014-19484036 TCACTTTGTCCTGCATACCTAGG + Intronic
1038410333 8:27353611-27353633 TGTCTTGGTCTGCCATTACTAGG - Intronic
1040483966 8:47853120-47853142 TGTCCTTGTCCTGCTATAGTAGG - Intronic
1041752618 8:61277460-61277482 TGTCTTTGTCCTGCATTACTGGG - Intronic
1043286882 8:78543268-78543290 TGCCTTTGACTTGCATTAATGGG + Intronic
1043392802 8:79807874-79807896 TGTCTTTGCCCTGTCTTGCTCGG - Intergenic
1043693633 8:83189318-83189340 TGTCTTTGTCCTTCATGATCTGG + Intergenic
1044198690 8:89409159-89409181 TGTCTTTGTCATGCAAGCCTTGG + Intergenic
1045070158 8:98494758-98494780 TGTCTTTGGCTTGCCTTTCTTGG - Intronic
1046030749 8:108781022-108781044 TGTCTTTCTCCTTTATTACTGGG - Intronic
1046763216 8:118042669-118042691 TCTCTTTGTCCTGAAATACCTGG + Intronic
1048305341 8:133280001-133280023 TGTCTCTGTCCTGCTTTCGTGGG + Intronic
1048465116 8:134659111-134659133 TGTATTTGTCCAGCATCACCAGG - Intronic
1048683683 8:136876718-136876740 TTTTATTGTCCTTCATTACTAGG + Intergenic
1050143566 9:2541879-2541901 TGTCTGTGTCCTTCATTCCCAGG + Intergenic
1057475838 9:95400314-95400336 TCTCTGTGTCCTCCATTTCTAGG - Intergenic
1058009566 9:99961427-99961449 TGTCTTTATTCTGCATAATTGGG + Intronic
1058258396 9:102799115-102799137 TTTCTCTATCTTGCATTACTCGG + Intergenic
1058563383 9:106253443-106253465 TGTATTTTTCCTGCCTTATTTGG + Intergenic
1059766249 9:117386554-117386576 TGTCTTTGGACTGCAGTTCTGGG + Intronic
1060367539 9:123033636-123033658 TGTCTTAGTTCTGCAGTACGCGG + Intronic
1061844874 9:133381849-133381871 TGTCTTTGCCCTGGATTCCACGG + Intronic
1185920533 X:4087179-4087201 TGTCTTTTTCCTTCACTACCTGG + Intergenic
1188155217 X:26733418-26733440 TGACTTTGTCCTTCAATATTGGG + Intergenic
1189878551 X:45464615-45464637 TTTCTTTGTCTTGCCTTATTAGG + Intergenic
1190948699 X:55120987-55121009 TTTCTTTGTCCTGCTTATCTGGG + Intronic
1191099783 X:56712928-56712950 TGTCTTTTTCCTAAATTAGTTGG + Intergenic
1191170004 X:57434783-57434805 TGTATTTGTCTTGGATTGCTGGG - Intronic
1196016783 X:110948053-110948075 TGTCTTTCTGCTGAATTATTGGG + Intronic
1197365462 X:125560468-125560490 TATCTGTGTCCTGCAGTATTGGG - Intergenic
1198196173 X:134364757-134364779 GGTCTTTGGCCTGCAGAACTGGG + Intergenic
1198322257 X:135529876-135529898 AGTCTGTGTACTGGATTACTAGG + Intronic