ID: 1041752619

View in Genome Browser
Species Human (GRCh38)
Location 8:61277461-61277483
Sequence GTGTCTTTGTCCTGCATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 134}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041752619_1041752621 -7 Left 1041752619 8:61277461-61277483 CCAGTAATGCAGGACAAAGACAC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1041752621 8:61277477-61277499 AAGACACAGGTGAAGACAGAAGG No data
1041752619_1041752629 21 Left 1041752619 8:61277461-61277483 CCAGTAATGCAGGACAAAGACAC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1041752629 8:61277505-61277527 TCTATGGGTGAGTATAGGGGAGG No data
1041752619_1041752627 17 Left 1041752619 8:61277461-61277483 CCAGTAATGCAGGACAAAGACAC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1041752627 8:61277501-61277523 ATGGTCTATGGGTGAGTATAGGG No data
1041752619_1041752623 -2 Left 1041752619 8:61277461-61277483 CCAGTAATGCAGGACAAAGACAC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1041752623 8:61277482-61277504 ACAGGTGAAGACAGAAGGGATGG No data
1041752619_1041752624 5 Left 1041752619 8:61277461-61277483 CCAGTAATGCAGGACAAAGACAC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1041752624 8:61277489-61277511 AAGACAGAAGGGATGGTCTATGG No data
1041752619_1041752628 18 Left 1041752619 8:61277461-61277483 CCAGTAATGCAGGACAAAGACAC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1041752628 8:61277502-61277524 TGGTCTATGGGTGAGTATAGGGG No data
1041752619_1041752625 6 Left 1041752619 8:61277461-61277483 CCAGTAATGCAGGACAAAGACAC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1041752625 8:61277490-61277512 AGACAGAAGGGATGGTCTATGGG No data
1041752619_1041752626 16 Left 1041752619 8:61277461-61277483 CCAGTAATGCAGGACAAAGACAC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1041752626 8:61277500-61277522 GATGGTCTATGGGTGAGTATAGG No data
1041752619_1041752622 -6 Left 1041752619 8:61277461-61277483 CCAGTAATGCAGGACAAAGACAC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1041752622 8:61277478-61277500 AGACACAGGTGAAGACAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041752619 Original CRISPR GTGTCTTTGTCCTGCATTAC TGG (reversed) Intronic
900487928 1:2932298-2932320 CTGTCTCTGTCCTGCATCCCCGG - Intergenic
900545985 1:3229415-3229437 CTGTCTTTCTCCTGCACTAAAGG + Intronic
900832015 1:4972248-4972270 ATTTCTTTCTCCTGCATTATAGG + Intergenic
905098694 1:35498941-35498963 GGGTCTTCTTCCTGCATTAGTGG + Intronic
911988873 1:104665186-104665208 GTTTTTTTTTCCTGTATTACTGG + Intergenic
914330646 1:146667170-146667192 GTTTCTTTCTTCTGCATTACAGG - Intergenic
914364515 1:146966256-146966278 GTGTTTATGTCCTGCTTTAAAGG + Intronic
915079750 1:153344068-153344090 GTGTCTTTGTCGTGCTTATCTGG - Intronic
916094317 1:161335044-161335066 GTCTCTTTTTCCTGCAGTATGGG + Intronic
918020554 1:180684038-180684060 ATGCCTATGTCCTGAATTACCGG + Intronic
918027080 1:180761185-180761207 ATGCCTATGTCCTGAATTACCGG - Intronic
922596084 1:226814319-226814341 GTGTGTCTGTCCTGCAGTGCAGG - Intergenic
924261294 1:242234391-242234413 CTGTCTTTGTCCTGCAGCAGGGG - Intronic
1065400699 10:25297014-25297036 GTGTCTGTGTCCTGCAACAGGGG + Intronic
1065720776 10:28626956-28626978 GTGTCTGTGTCCAGCACTAGAGG + Intergenic
1071822856 10:89295723-89295745 GTGTCTTTTTCCTGGAATATAGG - Intronic
1079393245 11:20040269-20040291 CTGCCTTTGTCTTGCATTATGGG - Intronic
1080328684 11:31109726-31109748 GGGTCTTTGTCTTGCATAAAAGG - Intronic
1080579994 11:33634401-33634423 GTGCCTTTCTCCAGCATGACTGG + Intronic
1081641713 11:44760192-44760214 GTGTCTGTCTCCTGCTTTAGTGG - Intronic
1084633651 11:70374834-70374856 GAATCTTTCTCCTGCATTACAGG + Intronic
1084778704 11:71395158-71395180 GGGTCTTTGTCTTTCGTTACTGG + Intergenic
1085383215 11:76139369-76139391 ATGTCTTTCTCCTGCAGGACTGG + Intronic
1085423765 11:76385070-76385092 GGGTCTTGGTCCAGCATCACTGG - Intronic
1085980761 11:81721259-81721281 GTATCTTTGTTCTCCAGTACTGG - Intergenic
1089243663 11:117102145-117102167 CTGCCTTTGTCTTGCATTACAGG - Intergenic
1089514912 11:119026277-119026299 GTGTCCTAGTCCTGCCTGACGGG - Intronic
1089829692 11:121316008-121316030 GTGGCGTTGTCCTGCATCAGAGG - Intergenic
1090135303 11:124191659-124191681 GACTCTTTCTCCTGCATTATTGG + Intergenic
1091413410 12:258924-258946 GTGTCTTTTTCCTACTTTGCTGG - Intronic
1091924758 12:4336435-4336457 GTGTGTGTGTGCTGCATTGCTGG - Intronic
1092564083 12:9647292-9647314 GTTTCTTTGTCCTGCTTATCTGG + Intergenic
1093723409 12:22473516-22473538 GTCTCTTTGTCCTCTCTTACTGG + Intronic
1094246857 12:28308065-28308087 GTGTCTCAGTTCTGGATTACAGG - Intronic
1094552513 12:31466038-31466060 GTGTCTCTGTGCTGCATTCTGGG - Intronic
1094594546 12:31852999-31853021 GTGGCTCTGTCCTCAATTACTGG - Intergenic
1100126769 12:91436597-91436619 TTGTCTTTGTCCAGGATTCCTGG + Intergenic
1100778405 12:97997474-97997496 GTGTCTTTCTCATGCTTTAGAGG - Intergenic
1103742610 12:123101283-123101305 GGGACCTTGTCCTGCATCACAGG - Intronic
1104398862 12:128459286-128459308 GAGTCTTTGTTCTGCACTGCTGG + Intronic
1106484897 13:30163344-30163366 GTGTCTTTGCCCTGTTTTCCTGG - Intergenic
1106629838 13:31459682-31459704 GTGTGTATGTCCTGGATAACAGG - Intergenic
1107765757 13:43732836-43732858 CTTGCTTTGTCTTGCATTACTGG - Intronic
1109142847 13:58737254-58737276 TTGTCATTTTCATGCATTACTGG + Intergenic
1109399076 13:61801217-61801239 GTGGCTTTTTCCTGAATTACAGG - Intergenic
1109707589 13:66117639-66117661 TTGTCTTTGTACTGCATAACCGG - Intergenic
1110207108 13:72927865-72927887 GTGTGTTTGTACTACATTAGTGG + Intronic
1111097093 13:83531153-83531175 GAGTCTTTGTCCCAGATTACTGG + Intergenic
1116277877 14:42860103-42860125 GTGCCTTTGTCCTTCTTTACAGG + Intergenic
1117457621 14:55913701-55913723 GTGGCTTTATCCTGGACTACTGG + Intergenic
1119640593 14:76311547-76311569 GAGGATTTGTCCTGCCTTACAGG + Intronic
1120459489 14:84776467-84776489 GTTTATTTGGCCTACATTACTGG - Intergenic
1120662819 14:87270789-87270811 GTTTCTATGTCCTGCATAAAAGG - Intergenic
1121896155 14:97649822-97649844 GTCTCTTTTTACTGCATTCCTGG - Intergenic
1122309665 14:100786417-100786439 GAGTCTGTGTCCTGCATGCCAGG + Intergenic
1122619833 14:103049455-103049477 GTCACTTTGTTCTCCATTACTGG + Intronic
1122736453 14:103846684-103846706 GTGTCTTTGTCCTGCCCTTAAGG - Intronic
1126352331 15:47757218-47757240 GTCTCTTTCTCCTCCATGACAGG - Intronic
1127671909 15:61202874-61202896 GTGTCTCTATCCTGCAACACAGG - Intronic
1133240517 16:4411742-4411764 GTCTCTCTGGCCTGCATTTCTGG - Intronic
1133596051 16:7293867-7293889 GTGTCTTTGACCTGTGTTCCAGG + Intronic
1135718737 16:24795885-24795907 GTGACTTTGTCTTTCCTTACAGG + Exonic
1139377882 16:66511802-66511824 GTGTCTTTGTCATGCGTCTCTGG - Exonic
1140002908 16:71043733-71043755 GTTTCTTTCTTCTGCATTACAGG + Intronic
1140192333 16:72828659-72828681 TGGTCTTTGTCCTGCATTTGGGG - Intronic
1140904153 16:79396148-79396170 GGGTGTTTGTCCTGCAGGACAGG + Intergenic
1153962491 18:10151513-10151535 GTGTCTCTGTCCTTCATTAGGGG + Intergenic
1155724670 18:29065423-29065445 CTTTCTTTGTGCTGCATTATGGG + Intergenic
1164916113 19:32053486-32053508 GTGGCTTTCTCCAGCATTTCCGG + Intergenic
1165108716 19:33488995-33489017 GGGTCTGTGGCCTGCATTGCTGG - Intronic
1166252948 19:41584149-41584171 GTGTCTTAGGCTTGAATTACTGG - Intronic
1167377170 19:49118471-49118493 GTGTGTCTGTCCTGCATCCCTGG + Exonic
1167687576 19:50966249-50966271 GTGTATTTGTCCTGAACAACTGG - Intronic
925608265 2:5681447-5681469 TTGTCTTTGTGCTGCAGTAAGGG - Intergenic
926290867 2:11529174-11529196 GTGTCTTTTTACTGCTTTACAGG - Intergenic
928883746 2:36125739-36125761 GTTTCTTTGTCCTGATTTAAAGG - Intergenic
929655310 2:43725225-43725247 GTTTCTTTGTCCTGCTTATCTGG + Intronic
932311080 2:70741819-70741841 GTGTCTTGGTACTGCAGTATAGG + Intronic
932441049 2:71735436-71735458 ATTTCTTGGTCCTGGATTACAGG + Intergenic
932798321 2:74716736-74716758 GACTCTTTGTCTTGCAGTACTGG - Intergenic
933450852 2:82448852-82448874 GTGTGTGTGTGCTGAATTACAGG + Intergenic
935673210 2:105572786-105572808 ATGTCATTGGCCTGCATTTCGGG + Intergenic
936106794 2:109631815-109631837 TAGTCTTTGTCCTGAATTCCTGG + Intergenic
940331499 2:152479939-152479961 GAGTGTATGTCCTGCTTTACAGG + Intronic
941689396 2:168483529-168483551 GTGTCTTTTTCCTGACTTAAAGG + Intronic
941885151 2:170520224-170520246 GAGGCTTTGTCCTACATTGCAGG - Intronic
947439794 2:230109345-230109367 GTGACTTTGTCTTGCATTTCGGG - Intergenic
947795173 2:232890035-232890057 GGGTCTCTGTCCTGCCTCACTGG + Intronic
947795211 2:232890188-232890210 GGGTCTCTGTCCTGCCTCACTGG + Intronic
947795222 2:232890227-232890249 GGGTCTCTGTCCTGCCTCACTGG + Intronic
1172662953 20:36579940-36579962 GTGTCTTTGTTCTGCTTTCCTGG + Intronic
1181494016 22:23277831-23277853 GTGACTTTGGGCTGCATTCCAGG + Intronic
949558520 3:5181377-5181399 TTGTCTTTTCACTGCATTACTGG + Intergenic
950701456 3:14752402-14752424 ATGCCTATGTCCTGAATTACCGG - Intronic
956722950 3:72134243-72134265 GTGTCTTTGTCCTACACAGCTGG + Intergenic
967218007 3:187226539-187226561 GTCTCATCGTCCTGCACTACTGG + Intronic
967329137 3:188273109-188273131 GTGTTTTTATCCTGCTTTACTGG - Intronic
968081906 3:195852264-195852286 GGGTCTTGGTCCTGGATGACTGG + Intergenic
969844397 4:9908732-9908754 GTGATGTTCTCCTGCATTACTGG + Intronic
970704023 4:18778274-18778296 GCTTCTTTGACCTGCATTAGTGG + Intergenic
973783450 4:54313100-54313122 TGGTATTTCTCCTGCATTACAGG + Intergenic
974257648 4:59481658-59481680 GTGTCTTTGACCTTGATTTCAGG - Intergenic
982200912 4:152959405-152959427 TTCTCTTTTTCCTGTATTACGGG + Intronic
983167515 4:164496309-164496331 GTCTCTCTTTCCTGCATTGCAGG - Intergenic
984013124 4:174394892-174394914 GTGTCTTTGTCCAGTTTTAGAGG + Intergenic
985301322 4:188492869-188492891 GTGTCTGTGTCCTGCAGTAGTGG - Intergenic
987455053 5:18133922-18133944 GTCTCTTTGTCTTGTATTTCTGG + Intergenic
990144074 5:52739100-52739122 GTGTTTTTGTCATGAACTACAGG - Intergenic
994242067 5:97434994-97435016 GTTTCTGTGTCCTGCAGTTCAGG + Intergenic
998317105 5:141192943-141192965 GTTTCTTTGTCCTGAAATACTGG - Exonic
1001217987 5:169873921-169873943 GAGGCTTTGGCCTGCATTCCAGG + Intronic
1004770273 6:18773334-18773356 TTGTCTTTCTCCTGAATTGCTGG + Intergenic
1010027123 6:71231886-71231908 GTGTCTTATTCTTGCATTACAGG + Intergenic
1012320327 6:97836856-97836878 CTGTTTTTGTTCTGCATTTCAGG - Intergenic
1013302919 6:108820964-108820986 GTGCCTTTGTCCTGAATTCAAGG + Intergenic
1014281514 6:119447028-119447050 GTGTGTTTGACCAGCATGACAGG + Intergenic
1014568581 6:122981053-122981075 GTCTCTTTGTCCTGCCTCATAGG - Intergenic
1015177242 6:130323393-130323415 GTGTCTTTGTCCATAATTTCAGG - Intronic
1016224461 6:141718161-141718183 GTGTCTTTGTCCTGAAAAATAGG - Intergenic
1018303210 6:162425681-162425703 ATCTCTTTGTGCTGCATTCCAGG - Intronic
1019202489 6:170329748-170329770 GTGTTTTTGTGCTACATTAAGGG + Intronic
1021802963 7:24326092-24326114 GTGGGCTTGTCCTCCATTACAGG + Intergenic
1021844862 7:24754637-24754659 GTGTCATTGTCCTGCTTTCTTGG - Intronic
1024247572 7:47481813-47481835 GGGTCTTTGCCCTGCAGGACTGG - Intronic
1026646580 7:72176035-72176057 GTGTCTTTGTCTTGCTTATCTGG - Intronic
1030000627 7:105056516-105056538 TTGTCTTCCTCCAGCATTACTGG + Intronic
1030138132 7:106278337-106278359 TTGTCTGTGTGCTGCATTAGGGG - Intronic
1031755269 7:125632251-125632273 GGTTCATGGTCCTGCATTACTGG - Intergenic
1037911396 8:22745736-22745758 GTGTCTTCCTCCTGTGTTACGGG - Intronic
1040811475 8:51459031-51459053 TTGCCTTTGTCTTGCATTGCTGG - Intronic
1041347439 8:56914414-56914436 CTGTCCTTGTCCTGTATTAGAGG - Intergenic
1041752619 8:61277461-61277483 GTGTCTTTGTCCTGCATTACTGG - Intronic
1043814653 8:84787387-84787409 TTATCTTTGTCCAGTATTACTGG + Intronic
1044665133 8:94627157-94627179 ATATCTTTGTCCTACAATACAGG + Intergenic
1046030750 8:108781023-108781045 CTGTCTTTCTCCTTTATTACTGG - Intronic
1048305340 8:133280000-133280022 GTGTCTCTGTCCTGCTTTCGTGG + Intronic
1053036275 9:34829193-34829215 TTGTTTTTGCCCTGAATTACTGG + Intergenic
1054457195 9:65439293-65439315 TTGTCTTTGTCCTTCATTTGTGG - Intergenic
1057224502 9:93283738-93283760 GTGTCCTTGTTCTGCATAATGGG - Intronic
1060233756 9:121845321-121845343 GTGTATTTCTCCTTCATTTCTGG - Intronic
1060857728 9:126928211-126928233 GTGCCTTTGTCCTACACTCCAGG - Intronic
1186876471 X:13822999-13823021 AAGACTTTGTCCTCCATTACCGG + Intronic
1190080672 X:47354687-47354709 GTGTCTTTTTGATGCAGTACAGG + Intergenic
1190948698 X:55120986-55121008 GTTTCTTTGTCCTGCTTATCTGG + Intronic
1191016864 X:55818719-55818741 GTGTCTGTGTCCTAGATTATGGG - Intergenic
1192090508 X:68151034-68151056 GTGTCATAGTCCTGCATTTTTGG - Intronic
1195766346 X:108299845-108299867 GTGCCCTTATCCTGAATTACTGG - Intronic
1197069851 X:122283536-122283558 TTGTCTTTGTACTGCATTGTTGG - Intergenic
1197651586 X:129071494-129071516 TTCTCTTTTTCCTGCATTCCAGG - Intergenic
1200300485 X:154969552-154969574 GTGTCTTATTCCTACTTTACAGG - Exonic