ID: 1041752629

View in Genome Browser
Species Human (GRCh38)
Location 8:61277505-61277527
Sequence TCTATGGGTGAGTATAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041752618_1041752629 22 Left 1041752618 8:61277460-61277482 CCCAGTAATGCAGGACAAAGACA 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1041752629 8:61277505-61277527 TCTATGGGTGAGTATAGGGGAGG No data
1041752619_1041752629 21 Left 1041752619 8:61277461-61277483 CCAGTAATGCAGGACAAAGACAC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1041752629 8:61277505-61277527 TCTATGGGTGAGTATAGGGGAGG No data
1041752617_1041752629 23 Left 1041752617 8:61277459-61277481 CCCCAGTAATGCAGGACAAAGAC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1041752629 8:61277505-61277527 TCTATGGGTGAGTATAGGGGAGG No data
1041752616_1041752629 24 Left 1041752616 8:61277458-61277480 CCCCCAGTAATGCAGGACAAAGA 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1041752629 8:61277505-61277527 TCTATGGGTGAGTATAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041752629 Original CRISPR TCTATGGGTGAGTATAGGGG AGG Intronic
No off target data available for this crispr