ID: 1041754543

View in Genome Browser
Species Human (GRCh38)
Location 8:61299706-61299728
Sequence TTGGATGAACACCACCACAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041754541_1041754543 -4 Left 1041754541 8:61299687-61299709 CCTCAGTTTTGCTTCTGTTTTGG 0: 1
1: 0
2: 3
3: 45
4: 483
Right 1041754543 8:61299706-61299728 TTGGATGAACACCACCACATAGG 0: 1
1: 0
2: 2
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041754543 Original CRISPR TTGGATGAACACCACCACAT AGG Exonic
905156873 1:35991880-35991902 TTGGATGAACGCCTCCAAAATGG - Intronic
907022964 1:51086787-51086809 TGGGATGTGCAGCACCACATTGG + Intergenic
908690407 1:66773412-66773434 TTGATTTTACACCACCACATGGG + Intronic
908698148 1:66868470-66868492 TTGGATGATGCCCACCACATTGG - Intronic
913214624 1:116610125-116610147 CTGGATGAACACACCCATATGGG + Intronic
917053668 1:170954582-170954604 TGGCATGAAAACAACCACATGGG - Intronic
923888695 1:238187079-238187101 TTGGATGAGGCCCACCACTTTGG + Intergenic
1062978687 10:1703925-1703947 CTGGCTGAACACCACCTCTTAGG - Intronic
1063437889 10:6049321-6049343 TTGGATGATCCCCACCACACTGG + Intronic
1074420414 10:113303813-113303835 TTGCATAACCACCACCAAATAGG - Intergenic
1075245871 10:120821813-120821835 TTGGATGCAGACAAGCACATGGG + Intergenic
1075862801 10:125691702-125691724 TGGCATCAACACCTCCACATTGG - Intergenic
1076209549 10:128629454-128629476 CTGGATGAAGACCAGGACATGGG - Intergenic
1084190169 11:67495083-67495105 CAGGATGAACGCCACCACGTCGG + Exonic
1086151553 11:83616316-83616338 TGGGAAGTAAACCACCACATTGG - Intronic
1088991768 11:114960289-114960311 TTGATTGATCACGACCACATGGG + Intergenic
1097843149 12:64341340-64341362 TGGGAGGAACAGCACCATATTGG + Intronic
1100804396 12:98266304-98266326 TTGTATGTATACCACCACTTTGG - Intergenic
1103994837 12:124822353-124822375 ATGGATGAACACCACAACACAGG + Intronic
1104331044 12:127845285-127845307 ATAGGTGAACACCACCACACTGG + Intergenic
1105218348 13:18303598-18303620 CTGGATGAACACACCCATATGGG + Intergenic
1106221957 13:27753664-27753686 TTGGATGATGCCCACCACATTGG + Intergenic
1107192943 13:37611708-37611730 TTGGAGGAACACCATTCCATAGG - Intergenic
1109294615 13:60514390-60514412 TTGGATGAGCACCATGACCTTGG + Intronic
1110115286 13:71806829-71806851 TTGGAAGAACTCCATCACTTTGG - Intronic
1116520018 14:45835484-45835506 TTGAATGAACAGTATCACATAGG + Intergenic
1118995259 14:70829882-70829904 TTGTCTGAACACCAGCACTTAGG - Intergenic
1119342730 14:73894243-73894265 TTGGATGAACATCAGCAGAGTGG + Intronic
1121679182 14:95778493-95778515 TTGGATGAGGCCCACCATATTGG + Intergenic
1123411216 15:20061432-20061454 TTGAATAAACACCAACACATTGG + Intergenic
1123520562 15:21068543-21068565 TTGAATAAACACCAACACACTGG + Intergenic
1125182648 15:36895165-36895187 TTGGATGGTCAGCAACACATGGG - Exonic
1129276903 15:74451616-74451638 TTGCATGTACATCACCACAATGG + Intronic
1131949483 15:97665681-97665703 TTGGATGATGCCCACCATATTGG - Intergenic
1132780568 16:1622369-1622391 ATGGGTGCACACCACCACAATGG - Intronic
1133104523 16:3498255-3498277 TTGGATGATGCCCACCACACTGG + Intergenic
1133277478 16:4647473-4647495 TTGATTTAAAACCACCACATAGG + Intronic
1135148724 16:19986657-19986679 TTGGATGATGCCCACCATATTGG + Intergenic
1147460708 17:40566354-40566376 ATGGATCCATACCACCACATAGG - Intergenic
1151843570 17:76635123-76635145 GTGGCTGAAAACCACCACACAGG - Intronic
1153610188 18:6877064-6877086 TTTGATAAACATTACCACATTGG - Intronic
1159692086 18:71500984-71501006 TTGGATCATCATCATCACATGGG + Intergenic
1159895496 18:73991802-73991824 AGGGATGCACCCCACCACATGGG - Intergenic
1160277212 18:77448199-77448221 ATGGATGAATACAACCGCATGGG + Intergenic
1162179350 19:8856832-8856854 ATGGATGTGCACCACCACACCGG - Intronic
1162289195 19:9766073-9766095 GTGGATGAACACAACAACTTGGG - Intronic
1163952818 19:20606481-20606503 CTGGATGGACAGAACCACATGGG - Intronic
1165369458 19:35395353-35395375 ATGGGTGCACACCACCACACTGG + Intergenic
1165920556 19:39295194-39295216 TTGGATGGTGCCCACCACATTGG + Intergenic
1166374022 19:42316932-42316954 GTAGATGAGCAGCACCACATGGG - Exonic
925607647 2:5674707-5674729 TTACATGAACACCAACACATTGG + Intergenic
925900031 2:8502650-8502672 TGGGATGAACTCCCCCACAGAGG + Intergenic
926151941 2:10430136-10430158 GTGGATGAGGACCCCCACATTGG + Intergenic
929991977 2:46797904-46797926 CAGGATGTACACCATCACATTGG - Intergenic
930060870 2:47287320-47287342 TAGGCCCAACACCACCACATTGG + Intergenic
941523178 2:166574561-166574583 TAGAAGGAACACCACCACAAAGG + Intergenic
941859530 2:170264340-170264362 TTGGATGATGACTGCCACATAGG - Intronic
946507781 2:220319661-220319683 CTGCATGAACACCACCATTTTGG - Intergenic
1168759120 20:336796-336818 ATAGGTGAACACCACCACACCGG + Intergenic
1171307112 20:24116221-24116243 TTGCATTAACAACACCTCATGGG + Intergenic
1184570454 22:45320575-45320597 ACAGATGAGCACCACCACATTGG + Intronic
950629963 3:14275780-14275802 CTGGCTGAACAGCATCACATGGG - Intergenic
951046145 3:18040772-18040794 TAGGATGAACACAACTAGATTGG - Intronic
951244189 3:20321371-20321393 TTGGATAAACTCCTGCACATGGG + Intergenic
951569802 3:24050006-24050028 ATGGATGAAAACAACAACATAGG - Intergenic
955690835 3:61589217-61589239 TTTTATGAACAGCACCACAATGG + Intronic
955793627 3:62612805-62612827 ATGGATGAACATCAACAAATGGG - Intronic
956197509 3:66667860-66667882 TTGGTTGGCCACCACCATATAGG + Intergenic
962850083 3:139301764-139301786 TTGGATGCTCAGCTCCACATGGG - Intronic
973699175 4:53519945-53519967 TAGGGTGAGCACCAGCACATCGG - Intronic
977392727 4:96432292-96432314 TTGGAATACCACCACCATATTGG + Intergenic
983115571 4:163811970-163811992 TTAGATGATGTCCACCACATTGG - Intronic
983695357 4:170521911-170521933 TTGGATGATGCCAACCACATTGG - Intergenic
993462212 5:88197173-88197195 CTTGAATAACACCACCACATGGG + Intronic
995602851 5:113817001-113817023 ATAGATGAACCCCAACACATGGG + Intergenic
996103108 5:119465334-119465356 TTGGCTTAACACCAACCCATTGG + Intronic
997854137 5:137358267-137358289 TTGGATGAACATCACCTGTTGGG - Intronic
999528105 5:152430587-152430609 TTGGATGGAGACCACAGCATTGG + Intronic
1001478938 5:172073292-172073314 ACAGATGCACACCACCACATTGG + Intronic
1003347068 6:5279829-5279851 TTGGATGAGGACCACCACATTGG + Intronic
1004988565 6:21111037-21111059 TTTGATAATCACCAACACATGGG - Intronic
1007197023 6:40071081-40071103 TTGGATGAACAAAATCAGATGGG - Intergenic
1008678927 6:53851516-53851538 TTGGATGATGCCCACTACATTGG + Intronic
1012020945 6:93918331-93918353 TTGGATGAAGCCCACTCCATTGG - Intergenic
1012471600 6:99578664-99578686 TTGGATGATGCCCACCACATTGG + Intergenic
1015763681 6:136692500-136692522 TTGGATGAAGGGCACCGCATAGG - Intronic
1017473928 6:154768919-154768941 TTAGGTGCACACCACCACACTGG - Intronic
1017615917 6:156246253-156246275 TTTGGAGAACACCACCACAGAGG - Intergenic
1018505377 6:164462146-164462168 TTGGATGATGCCCACCATATTGG + Intergenic
1020142239 7:5618819-5618841 TGGGATGAATACCACCACCCTGG + Intergenic
1024091374 7:45944254-45944276 TTAGAGGAACACAAACACATTGG - Intergenic
1029345377 7:99974847-99974869 TTGGATGAAGCCCACCACTATGG - Intronic
1031038036 7:116809186-116809208 TTGGAAGAACACAAACACACAGG + Intergenic
1031068738 7:117138444-117138466 TTTGATGTACACCAAGACATTGG - Exonic
1031616138 7:123882585-123882607 TTGGATGAGGCCCACCACACTGG - Intergenic
1034971260 7:155420730-155420752 TTGGATGAGGCCCACCACACTGG - Intergenic
1036822511 8:11951980-11952002 ATAGGTGCACACCACCACATTGG + Intergenic
1041754543 8:61299706-61299728 TTGGATGAACACCACCACATAGG + Exonic
1046963875 8:120141205-120141227 TAGGATGAGCAATACCACATTGG - Intronic
1047274318 8:123394231-123394253 TGGGATGATACCCACCACATTGG - Intronic
1047736807 8:127772734-127772756 TTGGAAGAACACCCTTACATGGG - Intergenic
1058021007 9:100088664-100088686 ATGGAATAACACCACCACTTAGG + Intronic
1059655447 9:116353541-116353563 CTGCATGAACACCACCAGCTGGG - Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1188612870 X:32120809-32120831 TTGGATGATAACAACCACCTTGG + Intronic
1190287208 X:48969645-48969667 TGGGATGGTCTCCACCACATTGG + Exonic
1190903746 X:54704857-54704879 TTGGATGAAAACGAAGACATTGG - Intergenic
1191938398 X:66451029-66451051 TTGGATGAAGCCCACCACATTGG + Intergenic
1195373071 X:104199244-104199266 CTGGATGAGCAGCATCACATAGG - Intergenic
1195599967 X:106734976-106734998 TTTGCTGTACACCACCACCTTGG + Intronic