ID: 1041758808

View in Genome Browser
Species Human (GRCh38)
Location 8:61341756-61341778
Sequence CCAATCTGTTAGTACAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041758808_1041758811 -9 Left 1041758808 8:61341756-61341778 CCAGGGTTGTACTAACAGATTGG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1041758811 8:61341770-61341792 ACAGATTGGGATAGAGCCACTGG No data
1041758808_1041758814 14 Left 1041758808 8:61341756-61341778 CCAGGGTTGTACTAACAGATTGG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1041758814 8:61341793-61341815 AATCTAACTGATGGCTTTTAAGG No data
1041758808_1041758816 27 Left 1041758808 8:61341756-61341778 CCAGGGTTGTACTAACAGATTGG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1041758816 8:61341806-61341828 GCTTTTAAGGGAATTTTGCAAGG No data
1041758808_1041758815 15 Left 1041758808 8:61341756-61341778 CCAGGGTTGTACTAACAGATTGG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1041758815 8:61341794-61341816 ATCTAACTGATGGCTTTTAAGGG No data
1041758808_1041758812 5 Left 1041758808 8:61341756-61341778 CCAGGGTTGTACTAACAGATTGG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1041758812 8:61341784-61341806 AGCCACTGGAATCTAACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041758808 Original CRISPR CCAATCTGTTAGTACAACCC TGG (reversed) Intronic
903165451 1:21517380-21517402 CCAATCTGATTGGGCAACCCTGG - Intronic
904912683 1:33947212-33947234 GCAGTCTGTTAGGACAGCCCTGG - Intronic
905537133 1:38731036-38731058 CTAATCTGTTAGTAGAACACAGG - Intergenic
910241422 1:85090751-85090773 CTAAGCTGTTAGTAGGACCCTGG + Intronic
918426487 1:184415403-184415425 ATTATCTGTTAGTAAAACCCAGG - Intronic
920675665 1:208037089-208037111 CTTATCTGTAAGTACAATCCTGG + Intronic
921465611 1:215483434-215483456 CCAGTCTGTTAGGACAAACCAGG - Intergenic
923292736 1:232562178-232562200 CCACTCTGTAAGGACAAGCCTGG - Intergenic
1074886743 10:117699957-117699979 GCAATCTGTTATGGCAACCCTGG + Intergenic
1081028427 11:38045825-38045847 CCAATCTGTTTGTAAAACCTAGG - Intergenic
1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG + Intronic
1086891690 11:92265847-92265869 CCCACCTGTTAGTACCACCTTGG + Intergenic
1088817577 11:113432205-113432227 TCAATCTGTTAGGACAGCCTGGG + Intronic
1091724059 12:2833572-2833594 CCAACCTGTCAGTACAGGCCTGG + Intronic
1095712277 12:45303157-45303179 GCAATCTGCTAGTACACCACAGG - Intronic
1111825425 13:93261734-93261756 CTTATCTGTTTGTCCAACCCTGG - Intronic
1112574733 13:100625542-100625564 CCAGACTGTTACTACAACCTCGG - Exonic
1114957050 14:27835554-27835576 GCAATTTGTTATGACAACCCTGG - Intergenic
1128667393 15:69548438-69548460 CCAATCTGCAAGTCCAACCAGGG - Intergenic
1138094815 16:54203258-54203280 CCAATCTGTTACTCAAGCCCTGG - Intergenic
1140903752 16:79393242-79393264 CCAGTCTGTAGGTACAGCCCAGG - Intergenic
1159118051 18:64137376-64137398 GCACTTTGTTAGGACAACCCTGG + Intergenic
1160379355 18:78439724-78439746 CCAATCTGTCTGTCCAACACAGG + Intergenic
1164078990 19:21846406-21846428 CTTTTCTGTTAGCACAACCCAGG + Intronic
927841357 2:26446767-26446789 GCAATCTGTCTGTACATCCCTGG - Intronic
939623922 2:144453110-144453132 ACAATCTGTTAATACAACTAAGG + Intronic
939909442 2:147962620-147962642 CCAATCTGGCAGTCCCACCCAGG + Intronic
940614861 2:156037755-156037777 CCTATGTGTAAGTACAAACCAGG - Intergenic
941411590 2:165163323-165163345 CAAATCTGTTAGTAAAGCCATGG + Intronic
943889706 2:193271278-193271300 CCAACCTGTTAGAACAGCCATGG - Intergenic
946002727 2:216496375-216496397 CCAATCTGTTATTCCAGCTCTGG - Intergenic
946477962 2:220027316-220027338 CCAATCTGTGAATACAAGGCTGG - Intergenic
947056157 2:226106955-226106977 TCAGTCTGTGAATACAACCCAGG - Intergenic
1170071797 20:12377320-12377342 CCAATCTGTGAGTAATACACTGG - Intergenic
949185912 3:1191309-1191331 CCAAGCTGTTAGTAGAAGCTTGG + Intronic
972079753 4:35136365-35136387 CCAACCTGTGAGAACAGCCCTGG - Intergenic
983584400 4:169340063-169340085 CCACTCAGATAGTACAAGCCTGG + Intergenic
986221004 5:5768630-5768652 CCAATATGTTAGAACCTCCCTGG + Intergenic
1009547102 6:65033915-65033937 CCAATCTGTGAGAGCAGCCCTGG + Intronic
1011270484 6:85573778-85573800 AAAATCTGGTAGTACACCCCAGG + Intronic
1015662274 6:135589005-135589027 ACAACCTGTGAGAACAACCCTGG - Intergenic
1026335038 7:69386895-69386917 CCAGTCTGTTAGTGCACTCCTGG + Intergenic
1030008900 7:105146076-105146098 CAAATCTGTTGATACAACTCAGG + Intronic
1035422946 7:158744330-158744352 CCAATCGGTTCGGAGAACCCTGG + Intronic
1037342841 8:17865128-17865150 CAAATCTGAAAATACAACCCAGG + Intronic
1037647200 8:20803205-20803227 CCAACCTGTTTATACAACTCTGG - Intergenic
1038234853 8:25742788-25742810 CCCATCTGTTTGTAGAATCCCGG + Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1046336470 8:112795246-112795268 CCAATCCCTTAGTACACCCTGGG - Intronic
1047195166 8:122714456-122714478 CCAATCTGTCCGCACCACCCAGG + Intergenic
1051603472 9:18897191-18897213 GACATCTGTTAGTATAACCCAGG - Intronic
1052534692 9:29732104-29732126 CAAACCTGATAGTAGAACCCAGG + Intergenic
1059534804 9:115070599-115070621 CCAATCCATCAGTAAAACCCTGG + Intronic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1196291795 X:113950484-113950506 CTATGCTGTTAGTACAACTCAGG - Intergenic
1198889169 X:141373856-141373878 CCAATCTATCAGTAAATCCCAGG - Intergenic