ID: 1041758813

View in Genome Browser
Species Human (GRCh38)
Location 8:61341786-61341808
Sequence AGCCATCAGTTAGATTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041758813_1041758817 4 Left 1041758813 8:61341786-61341808 CCACTGGAATCTAACTGATGGCT 0: 1
1: 0
2: 1
3: 12
4: 294
Right 1041758817 8:61341813-61341835 AGGGAATTTTGCAAGGCTGAAGG No data
1041758813_1041758816 -3 Left 1041758813 8:61341786-61341808 CCACTGGAATCTAACTGATGGCT 0: 1
1: 0
2: 1
3: 12
4: 294
Right 1041758816 8:61341806-61341828 GCTTTTAAGGGAATTTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041758813 Original CRISPR AGCCATCAGTTAGATTCCAG TGG (reversed) Intronic
901925475 1:12563508-12563530 AGCCTCCACTTAGATTTCAGAGG + Intergenic
902052986 1:13578856-13578878 AGCCATCAGTGAGTTTGCAAGGG + Intergenic
904378017 1:30093978-30094000 AGCCATGAGTGAGGTTCTAGGGG + Intergenic
906091386 1:43182346-43182368 AGCCATCAATCAGGTTCCTGAGG - Intronic
907926368 1:58958496-58958518 AGCAATCAGCTAGACTCCATGGG - Intergenic
909293326 1:73912349-73912371 AACCTTCACTTAGATTTCAGAGG - Intergenic
910304652 1:85748885-85748907 AGCAATCAGTGAGATTCCGTGGG - Intronic
910319488 1:85927434-85927456 AGCAATCAGTGAGATTCCGTGGG - Intronic
911716402 1:101138572-101138594 AGCCGTCTGTTTTATTCCAGGGG + Intergenic
912009444 1:104940792-104940814 AGCAATCAGTGAGACTCCATGGG + Intergenic
914700880 1:150132453-150132475 AGCCATCAATTTGATGCCACTGG + Intronic
915371877 1:155358213-155358235 ATCCATCATTTCTATTCCAGTGG - Intronic
916342868 1:163755878-163755900 AGCAATCAGTGAGATTCCGTGGG + Intergenic
917244606 1:172986920-172986942 AGCAATCAGCGAGATTCCATGGG + Intergenic
917684951 1:177406558-177406580 AGCAATCAGCGAGATTCCATGGG + Intergenic
918485847 1:185027481-185027503 AGCCTCCACTTAGATTTCAGAGG - Intergenic
918700166 1:187598033-187598055 AGCAATCAGTGAGATTCCGTGGG - Intergenic
919783552 1:201239872-201239894 AGCAATCAGTGAGACTCCATGGG + Intergenic
920312443 1:205056568-205056590 AGCCATCAGTCCTCTTCCAGGGG - Intronic
921880029 1:220245520-220245542 AGCAATCAGCGAGATTCCATGGG - Intronic
921964567 1:221074840-221074862 AGGCTTCATTTAGATTTCAGGGG - Intergenic
922200980 1:223401172-223401194 AGCAATCAGCGAGATTCCATGGG + Intergenic
923139827 1:231151742-231151764 AGCCTCCACCTAGATTCCAGGGG - Intergenic
924172274 1:241355843-241355865 AGACTTCAGTGAGATCCCAGTGG + Intronic
1063325275 10:5094335-5094357 AACCATCAGTCAGTTTGCAGGGG + Exonic
1064901146 10:20297186-20297208 AGCAATCAGTGAGACTCCATGGG + Intergenic
1066981955 10:42424582-42424604 AGCAACCAGTTAGATTCTAGGGG - Intergenic
1067308594 10:45091401-45091423 AGTCTGCAGTTTGATTCCAGTGG - Intergenic
1072055369 10:91749982-91750004 AGCAATCAGTGAGACTCCATGGG - Intergenic
1072405410 10:95147741-95147763 AGGAATCAGTGAGATTCCATGGG - Intergenic
1073908851 10:108315772-108315794 AGCAATCAGTGAGATTTCCGTGG + Intergenic
1079664290 11:23084207-23084229 AGCAATCAGTGAGACTCCATGGG - Intergenic
1079842799 11:25425498-25425520 AGCAATCAGTGAGACTCCATGGG - Intergenic
1082117826 11:48346346-48346368 AGCAATCAGTGAGACTCCATGGG - Intergenic
1082317806 11:50750881-50750903 AGCAATCAGTGAGACTCCATGGG + Intergenic
1082578475 11:54838227-54838249 AGCAATCAGTGAGATTCCGTGGG - Intergenic
1082642851 11:55686006-55686028 AGCAGTCAGTGAGATTCCATGGG - Intergenic
1082699468 11:56409926-56409948 AGCCTCCAATTAGATTTCAGAGG + Intergenic
1082758530 11:57102911-57102933 AGCCATCAGGTAGATTCAAAGGG + Intergenic
1083521068 11:63313359-63313381 AGCAATCAGTGAGATTCCGTGGG - Intronic
1086062225 11:82711621-82711643 AGGCTTCAGTTAGATCGCAGTGG + Intergenic
1086786128 11:90971915-90971937 AGCAATCAGCGAGATTCCATGGG + Intergenic
1087330771 11:96777433-96777455 AGCAATCAGTGAGACTCCATGGG + Intergenic
1087412380 11:97808429-97808451 AGCCTCCAGCTAGATTTCAGAGG + Intergenic
1088484722 11:110329467-110329489 AGCCTTCACCTAGATTTCAGAGG - Intergenic
1090403159 11:126461649-126461671 AGACACCATTTAGATTCCAGAGG - Intronic
1092324025 12:7510051-7510073 AGCAATCAGTGAGACTCCATGGG + Intergenic
1092707237 12:11298021-11298043 AGCAATCAGTGAGATTCCGTGGG - Intergenic
1093912461 12:24763234-24763256 ATCCTTCAGCCAGATTCCAGTGG - Intergenic
1093982412 12:25489267-25489289 AGCAATCAGTGAGATTCCGTGGG + Intronic
1094480475 12:30877305-30877327 GGCCATCACTAACATTCCAGGGG + Intergenic
1095060418 12:37681975-37681997 AGCAATCAGTGAGACTCCATGGG - Intergenic
1095534349 12:43228093-43228115 AGCAATCAGTGAGACTCCATGGG - Intergenic
1095718167 12:45371213-45371235 AGCAATCAGTGAGACTCCATGGG - Intronic
1095947755 12:47763524-47763546 AGCCAGGAGGTAGAGTCCAGAGG - Intronic
1096531182 12:52243852-52243874 AGGCATCTGTTATATTCCAGTGG - Intronic
1096952114 12:55484374-55484396 AGCAATCAGTGAGATTCCGTGGG - Intergenic
1097401633 12:59134793-59134815 AGCCTTCACCTAGATTTCAGAGG - Intergenic
1098836375 12:75428914-75428936 AGCCTTCACGTAGATTTCAGAGG + Intronic
1098843131 12:75501780-75501802 AGCCATCAGTAAGAGACAAGAGG - Exonic
1100337539 12:93645882-93645904 AGTCATCAGTTTGAATCCTGAGG + Intergenic
1100663866 12:96729444-96729466 AGCAATCAGCAAGATTCCATGGG + Intronic
1101537127 12:105628627-105628649 AGCAATCAGCGAGATTCCATGGG - Intergenic
1104225349 12:126827316-126827338 AGACATCTGTTAGGTTCCACTGG + Intergenic
1106136546 13:26977874-26977896 AGCCTTCAGGGAGATGCCAGGGG - Intergenic
1106294113 13:28394571-28394593 AGGCATCAGTTAGCTTTCATTGG + Intronic
1106936989 13:34733891-34733913 AGTCATCAGTTATAGGCCAGTGG + Intergenic
1107330711 13:39296608-39296630 AGCCTCCACTTAGATTTCAGAGG + Intergenic
1108168016 13:47712506-47712528 AGCAATCAGTGAGACTCCATGGG - Intergenic
1108517352 13:51215852-51215874 AGCTGTCAGCTATATTCCAGGGG - Intergenic
1109084380 13:57951303-57951325 AACCTTCATTTAGATTTCAGAGG - Intergenic
1109297517 13:60552724-60552746 AGCCTCCACTTAGATTTCAGAGG - Intronic
1110812160 13:79822831-79822853 AGCAATCAGTGAGACTCCATGGG + Intergenic
1110839735 13:80128163-80128185 AGCCATCCTTTTCATTCCAGGGG - Intergenic
1110841799 13:80152267-80152289 AGCCATCAGTGAGACTCCGTGGG - Intergenic
1110919855 13:81069853-81069875 AGCCATCAGCGAGATTCCGTGGG + Intergenic
1112723945 13:102280481-102280503 AGCCATCAGTGAGAGTGGAGGGG + Intronic
1112899978 13:104346119-104346141 AGCAATCAGTGAGATTCCATTGG + Intergenic
1114685398 14:24526315-24526337 AGCAATCAGTGAGACTCCATGGG - Intergenic
1114689046 14:24563410-24563432 AGCCTTCACCTAGATTTCAGAGG + Intergenic
1114951019 14:27753549-27753571 AGCCATAAGTAAGACTACAGTGG - Intergenic
1115121394 14:29941843-29941865 AGCCTTCATCTAGATTTCAGGGG + Intronic
1116364082 14:44038970-44038992 AGCCTTCACCTAGATTTCAGAGG + Intergenic
1117044579 14:51800246-51800268 AGCAATCAGTGAGATTCCGTGGG + Intergenic
1117343309 14:54809555-54809577 AGCCATCATTTAGGCTGCAGTGG + Intergenic
1117609422 14:57466659-57466681 ACCCATGGGTTACATTCCAGTGG - Intergenic
1118648844 14:67868438-67868460 AGCAATCAGTGAGACTCCATGGG - Intronic
1119885810 14:78140707-78140729 CGGCAACAGTTGGATTCCAGAGG + Intergenic
1120570522 14:86111110-86111132 AGCAATCAGTGAGACTCCCGTGG + Intergenic
1121152174 14:91645847-91645869 AGCCATCAGCGAGATTCCGTGGG + Intronic
1121520186 14:94580976-94580998 TCCCAACAGTTAGATTCTAGTGG - Intronic
1122310162 14:100789221-100789243 AGCCATCCTCTGGATTCCAGGGG - Intergenic
1124705444 15:31960205-31960227 AGCCACCACCTAGATTTCAGAGG + Intergenic
1124714956 15:32051413-32051435 AGCAATCAGTGAGACTCCATGGG + Intronic
1125228741 15:37427523-37427545 AGCAATCAGTGAGACTCCATGGG - Intergenic
1125358412 15:38840704-38840726 AGCAATCAGCGAGATTCCATGGG + Intergenic
1125990784 15:44105547-44105569 AACCATCAGTTAGATTTAAATGG + Intronic
1126815047 15:52446407-52446429 AGCCTCCACTTAGATTTCAGAGG + Intronic
1127157195 15:56140255-56140277 AGCAATCAGTGAGACTCCATGGG + Intronic
1128324904 15:66718018-66718040 AGCCCTCAGATGGATTCCATTGG + Intronic
1129083284 15:73061003-73061025 AGTCTTCAGTTATATTCCGGAGG - Intronic
1129178547 15:73857124-73857146 AGCCAGCCATTAGACTCCAGGGG + Intergenic
1129611624 15:77064214-77064236 AGCCATGAGTAAGATTTCTGGGG + Intronic
1129837484 15:78720197-78720219 AGCCATCAGCGAGACTCCATGGG - Intronic
1133514263 16:6492631-6492653 AGCGATCACACAGATTCCAGAGG - Intronic
1136068946 16:27776658-27776680 AGCCCTCATTTAAATGCCAGTGG - Intronic
1137041133 16:35614120-35614142 AGCAATCAGTGAGATTCCGTGGG + Intergenic
1137081927 16:36072287-36072309 AGCAATCAGTGAGATTCCGTGGG - Intergenic
1138838255 16:60464815-60464837 AGACAACAGTTAGATTGCACAGG + Intergenic
1139888889 16:70233887-70233909 ACCCATCAGTTACATTACATGGG - Intergenic
1142917385 17:3153024-3153046 AGCCATCAGTGAGACTCCACGGG + Intergenic
1142919452 17:3171665-3171687 AGCCTTCACCTAGATGCCAGAGG + Intergenic
1203160533 17_GL000205v2_random:44942-44964 AGCAATCAGTGAGATTCCGTGGG - Intergenic
1154424818 18:14264134-14264156 AGCCTTCACCTAGACTCCAGAGG + Intergenic
1154430227 18:14303006-14303028 AGCCTTCATCTAGACTCCAGTGG + Intergenic
1154432507 18:14319357-14319379 AGCCTTCATCTAGACTCCAGAGG + Intergenic
1155236799 18:23827934-23827956 AGCCATGAGGTAGGTGCCAGGGG - Intronic
1155381066 18:25223351-25223373 AGCCATCAGTCAGCTGGCAGGGG - Intronic
1156619510 18:38832707-38832729 AGCCATCAGTGGGCTTCCAAAGG + Intergenic
1158469162 18:57719612-57719634 AGCAATCAGTGAGATTCCGTGGG - Intronic
1158506277 18:58048641-58048663 AGCCATCAGTTTGCAACCAGTGG - Intronic
1160422414 18:78755961-78755983 AGTCATCACTTAGTGTCCAGAGG + Intergenic
1160422433 18:78756087-78756109 AGTCATCACTTAGTGTCCAGTGG + Intergenic
1160422439 18:78756129-78756151 AGTCATCACTTAGTGTCCAGAGG + Intergenic
1161606444 19:5217467-5217489 AGCCATCAGTTAAATACTAATGG + Intronic
1162682727 19:12358849-12358871 AGCCACCAGGCAGATGCCAGTGG + Intronic
1163972074 19:20808087-20808109 AGCAATCAGTGAGACTCCATGGG - Intronic
1164812750 19:31170960-31170982 AGCAATCAGTTTAATTACAGTGG + Intergenic
1166045787 19:40230053-40230075 AGCCAACAGAAAGCTTCCAGTGG - Intergenic
925246642 2:2389229-2389251 AGCCTCCACTTAGATTTCAGAGG - Intergenic
931199555 2:60084029-60084051 AGCAATCAGCGAGATTCCATGGG - Intergenic
931205499 2:60141556-60141578 AGCAATCAGTGAGATTCCGTGGG - Intergenic
932976695 2:76610625-76610647 AGCTATCATTTAAATTCCAAAGG - Intergenic
934627115 2:95869889-95869911 AGCAATTAGTTAGACTCCATGGG - Intronic
934806446 2:97231398-97231420 AGCAATCAGTTAGACTCCATGGG + Intronic
935596725 2:104884437-104884459 AGCCATTAGTTGGATGCCTGGGG - Intergenic
935739162 2:106131258-106131280 AGCAATCAGCGAGATTCCATGGG - Intronic
936700342 2:115004720-115004742 AGCAATCAGTGAGACTCCATGGG - Intronic
939502636 2:143006408-143006430 AGCAATCAGCGAGATTCCATGGG - Intronic
940149036 2:150578732-150578754 AGCCTTCATCTAGATTTCAGAGG - Intergenic
942972540 2:181974223-181974245 AACCATCTCTTAGATTCCTGTGG - Intronic
942995118 2:182251178-182251200 AGCCAGGAGTTTGACTCCAGAGG - Intronic
943457281 2:188123872-188123894 AGCAATCAGCGAGATTCCATGGG - Intergenic
946386944 2:219388966-219388988 CTCCATCAGTTTGATTGCAGAGG + Intronic
946910936 2:224459878-224459900 TGCCATCAGTTATCTTGCAGGGG - Intergenic
1170113019 20:12825779-12825801 AGCCAACAGTGACATGCCAGAGG + Intergenic
1173271397 20:41539032-41539054 AGCAAGCAGTTAGAGTTCAGTGG - Intronic
1176759769 21:10770118-10770140 AGCAATCAGTGAGACTCCATGGG - Intergenic
1176878837 21:14167089-14167111 AGCCATCAGTGAGACTCCGTGGG - Intronic
1177142848 21:17376404-17376426 AGCAATCAGTGAGATTCCGTGGG - Intergenic
1177900447 21:26908272-26908294 TGTCATCTGCTAGATTCCAGAGG + Intergenic
950939452 3:16878787-16878809 AGCCATGAGTGAGATTCCAGGGG - Intronic
951121707 3:18936134-18936156 AGCAATCAGTGAGATTCCGTGGG + Intergenic
954811301 3:53249981-53250003 GGACATCAGTTAGAGTCCATAGG + Intronic
954843082 3:53530438-53530460 TGCCATCCTCTAGATTCCAGGGG - Intronic
956328772 3:68081952-68081974 AGCAATCAGTGAGACTCCATGGG + Intronic
957711053 3:83859986-83860008 AGCCTCCATTTAGATTTCAGAGG - Intergenic
957868101 3:86050616-86050638 AGCTTTCATCTAGATTCCAGAGG - Intronic
958090434 3:88870199-88870221 AGCAATCAGTGAGATTCCGTGGG - Intergenic
958208545 3:90436296-90436318 AGCAATCAGTGAGACTCCATGGG + Intergenic
958555070 3:95662953-95662975 AGCAATCAGTGAGACTCCATGGG + Intergenic
959149462 3:102591289-102591311 AGCCTTCACCTAGATTTCAGAGG + Intergenic
959862263 3:111229688-111229710 AGCTTTCACTTAGATTTCAGAGG + Intronic
960000283 3:112724483-112724505 AGCAATCAGTGAGACTCCATGGG - Intergenic
960541968 3:118871431-118871453 AGCCATCGCCTAGATTTCAGAGG + Intergenic
963917700 3:150874428-150874450 AGCCATCAGTTTGTTTACACAGG + Intronic
964150509 3:153518686-153518708 AACCACCACTTAGATTTCAGAGG - Intergenic
964467742 3:157016083-157016105 AGCCATGAGACAGATTCAAGAGG + Intronic
965074936 3:163964084-163964106 AGCCTCCACTTAGATTTCAGAGG + Intergenic
965107471 3:164376005-164376027 AGAGATCTGTTAGATTTCAGTGG - Intergenic
967767103 3:193292959-193292981 GGACATCTGTTAGGTTCCAGAGG + Intronic
970020055 4:11557811-11557833 AGCAATCAGTGAGATTCCATGGG - Intergenic
971545460 4:27880026-27880048 AGCCTACATTTAGATTTCAGAGG - Intergenic
972096243 4:35350311-35350333 AGCCTTCATCTAGATTTCAGAGG - Intergenic
972336860 4:38114638-38114660 TCCCATCAGTCACATTCCAGAGG + Intronic
972878485 4:43395247-43395269 AGCCTTCACTTAGATTTCACAGG + Intergenic
973250762 4:48057599-48057621 AGCAATCAGTGAGATTCCGTGGG + Intergenic
973591486 4:52446690-52446712 AGCAATCAGTGAGACTCCATGGG - Intergenic
974097817 4:57384191-57384213 AGCAATCAGTGAGACTCCATGGG - Intergenic
974114910 4:57567960-57567982 AGCAATCAGTGAGATTCCGTGGG + Intergenic
975092830 4:70423668-70423690 AGCAATCAGTGAGACTCCATGGG + Intergenic
975513621 4:75220785-75220807 AGCAATCAGTGAGACTCCATGGG + Intergenic
975626996 4:76360205-76360227 AGCCTCCACTTAGATTTCAGAGG + Intronic
976905161 4:90227975-90227997 AGCAATCAGTGAGACTCCATGGG - Intronic
976920834 4:90441048-90441070 GGCCATTAGTTAGATTTAAGTGG + Intronic
977703707 4:100049095-100049117 AGCAATCAGTGAGATTCCGTGGG + Intergenic
977704068 4:100052059-100052081 AACCTCCAGTTAGATTTCAGGGG - Intergenic
978096679 4:104787351-104787373 AGCAATCAGCGAGATTCCATGGG - Intergenic
978261687 4:106767981-106768003 AGCCACCAGTCAGAGTCCTGAGG + Intergenic
978591874 4:110332624-110332646 AGCCATTAGCAAGATTCCTGTGG + Intergenic
978632523 4:110763246-110763268 AGCAATCAGTGAGACTCCATAGG + Intergenic
980426846 4:132636916-132636938 AGCAATCAGTGAGACTCCATGGG + Intergenic
980605499 4:135083543-135083565 AGCAATCAGTGAGATTCCGTGGG + Intergenic
983985939 4:174060718-174060740 AGCCTTCACCTAGATTTCAGAGG - Intergenic
985161660 4:187050869-187050891 AGCAATCAGTGAGACTCCATGGG - Intergenic
987482080 5:18472183-18472205 AGCAATCAGTGAGACTCCATGGG - Intergenic
987663293 5:20905024-20905046 AGCCTTCACCTAGATTTCAGAGG - Intergenic
987908492 5:24110243-24110265 AGCAATCAGTAATATTCCACCGG - Intronic
987909406 5:24122340-24122362 AGCCTTCACCTAGATTTCAGAGG - Intronic
988113691 5:26855542-26855564 AGCTCTCAGCTAGATTTCAGAGG - Intergenic
988759395 5:34297163-34297185 AGCCTTCACCTAGATTTCAGAGG + Intergenic
989653400 5:43718317-43718339 AGCAATCAGTGAGACTCCATGGG - Intergenic
989732874 5:44668867-44668889 AGCAATCAGTGAGACTCCATGGG - Intergenic
990911907 5:60860756-60860778 AGCCATCAGCGAGACTCCACGGG - Intergenic
991402120 5:66262625-66262647 AGCAATCAGTGAGACTCCATGGG + Intergenic
993848206 5:92972292-92972314 TGCCATCATTTAGTTTCCCGAGG - Intergenic
994592366 5:101789238-101789260 AGCTTTCACTTAGATTTCAGTGG + Intergenic
995771412 5:115674883-115674905 AGCAATCAGTGAGACTCCATGGG - Intergenic
996119631 5:119656579-119656601 AGCCATCAGGTAGATTATAAAGG + Intergenic
996881280 5:128299461-128299483 AGCAATCAGTGAGACTCCATGGG + Intronic
997380619 5:133433915-133433937 AGGCAGCAGTGGGATTCCAGGGG + Intronic
997793893 5:136788442-136788464 AGCAATCAGTGAGATTCCGTGGG + Intergenic
999433528 5:151544239-151544261 AGCCAACAGTTGGATCACAGGGG + Exonic
999520419 5:152345665-152345687 AGCAATCAGTGAGATTCCGTGGG + Intergenic
999555827 5:152741301-152741323 AGCAATCAGTGAGACTCCATGGG - Intergenic
1001144429 5:169171490-169171512 ATCCAACAGCAAGATTCCAGAGG + Intronic
1001361349 5:171089598-171089620 AGCAATCAGTGAGATTCCGTGGG + Intronic
1008131095 6:47720700-47720722 AGCTGGCTGTTAGATTCCAGGGG + Intronic
1008329606 6:50229083-50229105 AGCAATCAGTGAGACTCCATGGG + Intergenic
1009829540 6:68912938-68912960 AGCAATCAGTGAGATTCCATGGG - Intronic
1009876778 6:69515504-69515526 AGCAATCAGCGAGATTCCATGGG - Intergenic
1010587870 6:77676564-77676586 AGCCTTCAATAAGATTCCTGTGG + Intergenic
1011364791 6:86569940-86569962 AGCAATCAGTGAGACTCCATGGG - Intergenic
1011392830 6:86873194-86873216 AGCAATCAGTGAGACTCCATGGG - Intergenic
1011619668 6:89230902-89230924 AGCAATCAGCGAGATTCCATGGG + Intronic
1012292181 6:97470210-97470232 TACCTTTAGTTAGATTCCAGAGG - Intergenic
1012363956 6:98416864-98416886 AGCAATCAGTGAGATTCCGTGGG - Intergenic
1012387935 6:98703422-98703444 AGCAATCAGTGAGATTCCGTGGG - Intergenic
1013696030 6:112704111-112704133 AGCAATCAGTGAGATTCCGTGGG - Intergenic
1013767065 6:113587355-113587377 AGCCATCAGATACCTTTCAGAGG + Intergenic
1014040186 6:116816889-116816911 AGCAATCAGTGAGATTCCGTGGG - Intronic
1014143610 6:117971616-117971638 AACCTTCACTTAGATTTCAGAGG - Intronic
1015013186 6:128376269-128376291 AACCTCCAGTTAGATTTCAGAGG - Intronic
1015578757 6:134701383-134701405 AGCTATCAGGTAGATTCCTAAGG - Intergenic
1016749860 6:147620575-147620597 AGCCATAAGATATATTACAGAGG + Intronic
1018155707 6:160983518-160983540 AGCCTCCACTTAGATTTCAGCGG + Intergenic
1018354229 6:162995380-162995402 AGCAATCAGCGAGATTCCATGGG + Intronic
1018984609 6:168626758-168626780 TGGCATCACTCAGATTCCAGGGG + Intronic
1021347936 7:19550461-19550483 AGCAATCAGTTAGAATTAAGTGG + Intergenic
1021671146 7:23036093-23036115 AGCAATCAGCGAGATTCCGGGGG - Intergenic
1022959379 7:35412103-35412125 AGACCTCAGTCAGATTCCAAAGG + Intergenic
1025153822 7:56585161-56585183 AGCAATCAGCGAGATTCCATGGG - Intergenic
1025320846 7:58091823-58091845 AGCAATCAGCAAGACTCCAGTGG - Intergenic
1028886642 7:95941566-95941588 AGCAATCAGTGAGATTCCATGGG + Intronic
1030321967 7:108178823-108178845 TTCCATTAGTTAGTTTCCAGGGG - Intronic
1030466095 7:109905794-109905816 AGCAATCAGTGAGATTCCATGGG - Intergenic
1030518156 7:110563176-110563198 AGCAATCAGCGAGATTCCATGGG + Intergenic
1030531117 7:110712649-110712671 AGCAATCAGTGAGATTCCGTGGG + Intronic
1030752181 7:113241791-113241813 AGCCTCCACTTAGATTTCAGAGG + Intergenic
1031617130 7:123894864-123894886 AGCAATCAGTGAGACTCCATGGG - Intergenic
1032940233 7:136780402-136780424 AGCAATCAGTGAGACTCCATGGG + Intergenic
1033498729 7:141926326-141926348 AGCAATCAGTGAGATTCCGTGGG + Intronic
1033844800 7:145418725-145418747 AGCAATCAGTGAGACTCCATGGG + Intergenic
1041013835 8:53571258-53571280 AGCCTCCACTTAGATTTCAGAGG + Intergenic
1041758813 8:61341786-61341808 AGCCATCAGTTAGATTCCAGTGG - Intronic
1041806085 8:61850767-61850789 AGCAATCAGTGAGACTCCATGGG + Intergenic
1044182982 8:89218549-89218571 AGCAATCAGTGAGACTCCATGGG - Intergenic
1046867304 8:119165023-119165045 AGCAGTCAGTGAGATTCCATGGG + Intronic
1047415422 8:124661063-124661085 AGCCACCAATAAGATGCCAGAGG + Intronic
1047877784 8:129157765-129157787 AGCAATCAGTGAGATTCCGTGGG + Intergenic
1048076522 8:131077578-131077600 AGCCATCTGTTAGAGTCGACAGG + Intergenic
1048490162 8:134884960-134884982 AGCCATCTGAAAGCTTCCAGAGG + Intergenic
1048741371 8:137564224-137564246 AGCAATCAGTGAGATTCCATGGG + Intergenic
1050528227 9:6564423-6564445 AGCCATAAGTAACCTTCCAGTGG + Intronic
1050938199 9:11425012-11425034 AGCCTTCACCTAGATTTCAGAGG - Intergenic
1051440631 9:17078996-17079018 AGCCATAAATTTGATGCCAGAGG - Intergenic
1052250299 9:26390249-26390271 AACCTTCACTTAGATTTCAGAGG + Intergenic
1052488236 9:29130168-29130190 ACCCATCAGTCAGCTTGCAGAGG + Intergenic
1052726192 9:32230671-32230693 AGCAATCAGTGAGACTCCATGGG + Intergenic
1054410162 9:64804995-64805017 AGCAATCAGTGAGACTCCATGGG + Intergenic
1054887772 9:70217412-70217434 ACCCAGCAGTCAAATTCCAGAGG + Intronic
1055346621 9:75346341-75346363 AGCAATCAGTGAGACTCCATGGG + Intergenic
1056038691 9:82637342-82637364 AGCTCCCAGTTACATTCCAGTGG - Intergenic
1057965505 9:99499106-99499128 AGCCATCAGCGAGATTCCGTGGG - Intergenic
1058544900 9:106050854-106050876 AGCCAGAAGTTTGATTCCACTGG - Intergenic
1058557680 9:106187256-106187278 AGCAATCAGTGAGACTCCATGGG + Intergenic
1203397843 Un_KI270519v1:44232-44254 AGCAATCAGTGAGACTCCATGGG - Intergenic
1203421299 Un_KI270521v1:470-492 AGCAATCAGTGAGATTCCGTGGG + Intergenic
1186344627 X:8679087-8679109 AGGCATCTGTTAGGTTCAAGGGG + Intronic
1188865825 X:35312063-35312085 TGCCATCAGTTACATGCCACTGG - Intergenic
1189036897 X:37502791-37502813 AGCCTCCACTTAGATTTCAGAGG - Intronic
1190135147 X:47789312-47789334 AGCAATCAGCGAGATTCCATGGG + Intergenic
1191020241 X:55851529-55851551 AGCAATCAGTGAGACTCCATGGG + Intergenic
1191087729 X:56587289-56587311 AGCAATCAGTGAGACTCCATGGG + Intergenic
1191266197 X:58396847-58396869 AGCAATCAGTGAGACTCCATGGG + Intergenic
1191982641 X:66943157-66943179 AGCAATCAGTGAGACTCCATGGG - Intergenic
1192850766 X:74953619-74953641 AGCAATCAGTGAGACTCCATGGG - Intergenic
1192872639 X:75199347-75199369 AGCCATCAGTCAGAGTCATGAGG + Intergenic
1192905542 X:75546781-75546803 TGCCATCAGTTAGATTTCCTTGG + Intergenic
1193157443 X:78189217-78189239 AGCAATCAGTGAGACTCCATGGG - Intergenic
1193332944 X:80256106-80256128 AGCCTCCACCTAGATTCCAGAGG + Intergenic
1193522884 X:82552184-82552206 AGCAATCAGTGAGATTCCGTGGG + Intergenic
1193564961 X:83065250-83065272 AGCAATCAGTGAGATTCCGTGGG + Intergenic
1194629803 X:96269753-96269775 AGCAATCAGTGAGACTCCATGGG - Intergenic
1195126097 X:101811450-101811472 AGCAATCAGTGAGACTCCATGGG + Intergenic
1195835812 X:109113672-109113694 AGCAATCAGTGAGATTCCGTGGG - Intergenic
1197420807 X:126235095-126235117 AGCAATCAGTGAGAGTCCATGGG + Intergenic
1198658066 X:138936264-138936286 AGCCATCAGTAAGATTACTAAGG - Intronic
1198667918 X:139045069-139045091 AGCCTCCACTTAGATTTCAGAGG - Intronic
1200460021 Y:3443914-3443936 AGCAATCAGTGCGATTCCATGGG - Intergenic
1200820275 Y:7575685-7575707 AGCAATCAGTGAGACTCCATGGG + Intergenic
1201053738 Y:9967372-9967394 AGCAATCAGTGAGACTCCATGGG + Intergenic
1201230614 Y:11860706-11860728 AGCAATCAGTGAGACTCCATGGG + Intergenic
1201393594 Y:13524381-13524403 AGCAATCAGTGAGACTCCATGGG - Intergenic
1201545617 Y:15158665-15158687 AGCAATCAGTGAGACTCCATGGG + Intergenic
1201708705 Y:16965890-16965912 AGCCCTCAGTTTGATCCCATAGG + Intergenic
1202327302 Y:23704967-23704989 AGCAATCAGTGAGACTCCATGGG - Intergenic
1202543468 Y:25965085-25965107 AGCAATCAGTGAGACTCCATGGG + Intergenic