ID: 1041758815

View in Genome Browser
Species Human (GRCh38)
Location 8:61341794-61341816
Sequence ATCTAACTGATGGCTTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041758808_1041758815 15 Left 1041758808 8:61341756-61341778 CCAGGGTTGTACTAACAGATTGG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1041758815 8:61341794-61341816 ATCTAACTGATGGCTTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041758815 Original CRISPR ATCTAACTGATGGCTTTTAA GGG Intronic
No off target data available for this crispr