ID: 1041758816

View in Genome Browser
Species Human (GRCh38)
Location 8:61341806-61341828
Sequence GCTTTTAAGGGAATTTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041758808_1041758816 27 Left 1041758808 8:61341756-61341778 CCAGGGTTGTACTAACAGATTGG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1041758816 8:61341806-61341828 GCTTTTAAGGGAATTTTGCAAGG No data
1041758813_1041758816 -3 Left 1041758813 8:61341786-61341808 CCACTGGAATCTAACTGATGGCT 0: 1
1: 0
2: 1
3: 12
4: 294
Right 1041758816 8:61341806-61341828 GCTTTTAAGGGAATTTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041758816 Original CRISPR GCTTTTAAGGGAATTTTGCA AGG Intronic
No off target data available for this crispr