ID: 1041759287

View in Genome Browser
Species Human (GRCh38)
Location 8:61346619-61346641
Sequence CTAGTTTACAAGGAGGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041759287 Original CRISPR CTAGTTTACAAGGAGGCATC AGG (reversed) Intronic
901117233 1:6856988-6857010 CTAGTTTCCAAGGTGGCCTATGG - Intronic
901933905 1:12615159-12615181 CTACTTTATAATGAGGCTTCTGG - Intronic
901933907 1:12615184-12615206 CTACTTTATAATGAGGCTTCTGG - Intronic
905055168 1:35087349-35087371 CTAATTTTCCAGGAGGAATCTGG + Intronic
905255277 1:36677701-36677723 CTTGTTTACAAGGCAGCATCAGG + Intergenic
907715721 1:56924215-56924237 CTTATTAACAAGGAGTCATCTGG + Intergenic
910682819 1:89884672-89884694 CTAGTTTACAATGAGAAAGCTGG - Intronic
911545829 1:99215255-99215277 CTAGTTTAGAATGAGGAAGCTGG - Intergenic
912209714 1:107544895-107544917 GTAGTTTGAGAGGAGGCATCTGG - Intergenic
915805625 1:158845947-158845969 CAACTTTACAAGCAAGCATCTGG + Exonic
917285064 1:173414894-173414916 CTAGTTGAGAAGAAGGCTTCAGG - Intergenic
921357113 1:214295507-214295529 GTAATTTACAAGGAGGAAGCTGG - Intronic
921578339 1:216864731-216864753 CAACTTAAGAAGGAGGCATCTGG + Intronic
921604607 1:217138660-217138682 CTAGTTAACAATGATGCCTCCGG + Intergenic
922888322 1:229037918-229037940 CCAGTTTACAAGGAGGAAATTGG - Intergenic
923997480 1:239511925-239511947 CTTGTTTAAAAAGAGGAATCTGG + Intronic
1063395140 10:5679568-5679590 CTTGTCTCCAAGGAGGAATCAGG + Intergenic
1063471545 10:6291115-6291137 TTAGTTTGCAAGGAGGAATCAGG + Intergenic
1075204086 10:120431790-120431812 ATAGTTTATAAGATGGCATCAGG + Intergenic
1075415967 10:122264727-122264749 TTATTTTACAAGGAGGAAACAGG + Intergenic
1080687449 11:34526980-34527002 CTAATTTACACAGAGGCACCAGG + Intergenic
1082859658 11:57842644-57842666 CTAGTTTACCAGAGAGCATCAGG + Intergenic
1084212125 11:67629164-67629186 CTAGTTTACTGGGAGGCCCCAGG + Intronic
1086924048 11:92621022-92621044 ATAGTTTAAAATGAGGCCTCTGG - Intronic
1087119065 11:94553974-94553996 CTGGTTTACCAGGAGGCTTGTGG + Intronic
1088159658 11:106854474-106854496 CTAGTGGACAAGGGGGCATGTGG + Intronic
1088975565 11:114813304-114813326 CTGATTTACAAGGAGGAAGCTGG - Intergenic
1093730941 12:22565083-22565105 CTAGTTTAAAAGAAGACAGCTGG + Intergenic
1098221867 12:68278629-68278651 CTAATTTGCCAGGAGGCATGAGG - Intronic
1104050661 12:125191371-125191393 CTAGTTTACAAGGGAGGATCTGG + Intronic
1107863106 13:44679790-44679812 AGAGTTTACATGGAGGCATTTGG + Intergenic
1112729136 13:102339943-102339965 CTAGCTTGCTAGGAGGCAACTGG + Intronic
1114352426 14:21867985-21868007 CTGGTTTGCAAGGAGAAATCTGG - Intergenic
1114356686 14:21917370-21917392 CTGGTTTGCAAGGAGAAATCTGG - Intergenic
1116615043 14:47124871-47124893 AAAGTTTACAAGGTGCCATCAGG - Intronic
1118113600 14:62750067-62750089 ATATTTTACATGGGGGCATCTGG + Intronic
1119636120 14:76274820-76274842 CTACTTTACAAGGATGTATGTGG - Intergenic
1120990373 14:90371271-90371293 CTTGTATAAAAGGATGCATCTGG + Intergenic
1122444119 14:101756904-101756926 CTAGTTTTCGGGGAGGCCTCAGG + Intergenic
1123574152 15:21649411-21649433 ATATTTTAAAAGGAGGCATGAGG + Intergenic
1123610768 15:22091996-22092018 ATATTTTAAAAGGAGGCATGAGG + Intergenic
1202983016 15_KI270727v1_random:383755-383777 ATATTTTAAAAGGAGGCATGAGG + Intergenic
1140714484 16:77709708-77709730 CTCCTTTACAAGGAGGCTTAAGG + Intergenic
1141047681 16:80730969-80730991 ATAGATTACAAGGAGGCAAGAGG + Intronic
1142651445 17:1355736-1355758 CTATTTTACAAGGAGGAGGCTGG + Intronic
1159450813 18:68599747-68599769 CTAGTTTACATGGTAGCATAAGG - Intergenic
1167121345 19:47519056-47519078 CTAGTTTACAAGGAGGTAAGAGG + Intergenic
927872597 2:26633174-26633196 CTCGTTCCCCAGGAGGCATCAGG + Intronic
927998931 2:27506477-27506499 CAAGATTTCCAGGAGGCATCTGG - Exonic
928132455 2:28662536-28662558 CTACCTTAAAAGGAGGCATTCGG + Intergenic
930531664 2:52596103-52596125 CTGGTTGACTAGGAGCCATCTGG + Intergenic
931912741 2:66919522-66919544 TTAGCTTAGAAGGAGGCATGTGG + Intergenic
931986329 2:67745728-67745750 CTAGTTTAAAAGGAGGAAGATGG - Intergenic
937457672 2:122056673-122056695 CTAGTTTAATAGGAGACAGCTGG - Intergenic
937637285 2:124170552-124170574 GTAGTTTATCTGGAGGCATCGGG - Intronic
939341853 2:140906194-140906216 ATAGATTATAAGGAGGAATCTGG - Intronic
943760128 2:191599007-191599029 CTACTTTACAACCAGGGATCAGG + Intergenic
1169766176 20:9150643-9150665 CTAGTTTAGAAGGAGGCCTGAGG + Intronic
1170873558 20:20230850-20230872 CAAGACTACAAGGAGGCAGCAGG - Intronic
1172649556 20:36493150-36493172 CCATTTTACAAGGAGGAAACTGG + Intronic
1172874240 20:38154687-38154709 ATAGTGTATAAGGAGGCAGCTGG + Intronic
1174439739 20:50540975-50540997 CTAGTTTGCAAGGAGGCTGTGGG + Intronic
1177783899 21:25649085-25649107 TTAGGATATAAGGAGGCATCAGG - Intronic
1179536133 21:42054019-42054041 ATCGTTTTCAAGGAGGGATCAGG + Intergenic
1182898813 22:33881154-33881176 CTGGTACACAAGAAGGCATCTGG - Intronic
1183565150 22:38609106-38609128 TTAGGGTCCAAGGAGGCATCTGG + Intronic
949191952 3:1260784-1260806 CTTCTTTACACGGCGGCATCAGG - Intronic
950885754 3:16361493-16361515 CTATTTTTGAAAGAGGCATCAGG + Intronic
953136354 3:40185648-40185670 CTAGCTTCCAAAGAGGCATGAGG + Intronic
958662006 3:97080471-97080493 CTATTTTTGCAGGAGGCATCTGG + Intronic
959470047 3:106738999-106739021 ATAGTTTAGAAGGAGGGTTCTGG + Intergenic
960317320 3:116194168-116194190 CTAGTTTACATGGAAAAATCTGG - Intronic
961680214 3:128594856-128594878 CTAGGTTACAAAGAGGAAACAGG - Intergenic
964866367 3:161266199-161266221 CTAATATACAAGGAGGGATTGGG + Intergenic
966373756 3:179274873-179274895 CTATGTTACAATGAGGAATCTGG + Intergenic
967859161 3:194138780-194138802 TTACTTTACAAGCAGCCATCTGG + Intergenic
975880643 4:78902210-78902232 ATAGTTTATAAGTAGGAATCTGG + Intronic
976780709 4:88755577-88755599 ATTGTTTAGAAAGAGGCATCAGG + Intronic
980909404 4:138980119-138980141 CCAGTTTACAAAGAGGAAACAGG + Intergenic
987424989 5:17762922-17762944 ATAGGTTACAAGGAGGTATCAGG + Intergenic
988122692 5:26987683-26987705 CTAGATTACAAGCAGGAAGCAGG + Intronic
991478246 5:67047168-67047190 CTAGATTAAAAGGAGGAAGCAGG - Intronic
991651261 5:68856845-68856867 CTAGTTGACAAAGAAGCAGCAGG - Intergenic
992681065 5:79153685-79153707 CTACTTTAGAAGGAAGGATCTGG + Intronic
993083434 5:83332041-83332063 TTATTTTACATGGAAGCATCTGG + Intronic
993613228 5:90079883-90079905 ATAGTTTACATGTAGGTATCAGG - Intergenic
995515718 5:112953342-112953364 ATAATTTGCAAGGAGTCATCTGG - Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
1004369357 6:15038716-15038738 CCAGTTTACAAGGAGCCAGAAGG + Intergenic
1004983046 6:21047672-21047694 ATAGTTTATTAGGAGGCATAAGG + Intronic
1010183930 6:73121102-73121124 ATAGTTTACAATGAGGCAATGGG + Intronic
1027706489 7:81540330-81540352 TCTGTTTACAAGGAGGCATATGG + Intergenic
1031910165 7:127508096-127508118 CTAATTTGCAAGGAGGGACCGGG + Intergenic
1032071436 7:128809913-128809935 GTAGTTTACAAAGTGGCTTCAGG - Intronic
1040744946 8:50631002-50631024 CTAGTTTTCCAGGAGACCTCAGG + Intronic
1041759287 8:61346619-61346641 CTAGTTTACAAGGAGGCATCAGG - Intronic
1041933741 8:63314526-63314548 CTCCTTTACAAGGAGGAATTGGG + Intergenic
1045298073 8:100889505-100889527 CAAGTCTACATGGCGGCATCAGG + Intergenic
1046091705 8:109511041-109511063 CTCATTTCCAAGGATGCATCAGG + Intronic
1046445962 8:114319617-114319639 TTATTTTAAAAGGAGGGATCTGG - Intergenic
1050540533 9:6665723-6665745 CTAGTTTACAGGGACTCAGCTGG - Intergenic
1054699695 9:68400582-68400604 CTTTTTTACAAAGAGACATCTGG + Intronic
1061438541 9:130582675-130582697 CTAGGTTACAAGGGGACCTCTGG + Intronic
1187033535 X:15513297-15513319 CAAGTTTGCAGGGAGGCTTCTGG - Intronic
1189424789 X:40889269-40889291 TTTGTTTGCAAGGAGGAATCAGG + Intergenic
1192013407 X:67299904-67299926 CTGAGTTACAAGGATGCATCAGG - Intergenic
1194339338 X:92690546-92690568 ATAGTTTGCAAGGAGGCAATGGG - Intergenic
1194701247 X:97117609-97117631 CTAGGTAAAAAGGAGGCATGTGG + Intronic
1199514489 X:148660709-148660731 CCAGTATTCAAGGAGCCATCTGG - Intronic
1200386082 X:155892245-155892267 AAAGTTTACAAGGAGGCTTAGGG - Intronic
1200647723 Y:5807326-5807348 ATAGTTTGCAAGGAGGCAATGGG - Intergenic