ID: 1041761202

View in Genome Browser
Species Human (GRCh38)
Location 8:61368464-61368486
Sequence AATGTTCTTGTCCAAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 508}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041761202_1041761210 22 Left 1041761202 8:61368464-61368486 CCTTGTTCTTGGACAAGAACATT 0: 1
1: 0
2: 5
3: 40
4: 508
Right 1041761210 8:61368509-61368531 TAGCATTGGTCAGATAGGGGTGG No data
1041761202_1041761211 27 Left 1041761202 8:61368464-61368486 CCTTGTTCTTGGACAAGAACATT 0: 1
1: 0
2: 5
3: 40
4: 508
Right 1041761211 8:61368514-61368536 TTGGTCAGATAGGGGTGGACTGG No data
1041761202_1041761209 19 Left 1041761202 8:61368464-61368486 CCTTGTTCTTGGACAAGAACATT 0: 1
1: 0
2: 5
3: 40
4: 508
Right 1041761209 8:61368506-61368528 CAGTAGCATTGGTCAGATAGGGG No data
1041761202_1041761213 29 Left 1041761202 8:61368464-61368486 CCTTGTTCTTGGACAAGAACATT 0: 1
1: 0
2: 5
3: 40
4: 508
Right 1041761213 8:61368516-61368538 GGTCAGATAGGGGTGGACTGGGG No data
1041761202_1041761205 8 Left 1041761202 8:61368464-61368486 CCTTGTTCTTGGACAAGAACATT 0: 1
1: 0
2: 5
3: 40
4: 508
Right 1041761205 8:61368495-61368517 TGTTTTGTCCTCAGTAGCATTGG No data
1041761202_1041761212 28 Left 1041761202 8:61368464-61368486 CCTTGTTCTTGGACAAGAACATT 0: 1
1: 0
2: 5
3: 40
4: 508
Right 1041761212 8:61368515-61368537 TGGTCAGATAGGGGTGGACTGGG No data
1041761202_1041761208 18 Left 1041761202 8:61368464-61368486 CCTTGTTCTTGGACAAGAACATT 0: 1
1: 0
2: 5
3: 40
4: 508
Right 1041761208 8:61368505-61368527 TCAGTAGCATTGGTCAGATAGGG No data
1041761202_1041761207 17 Left 1041761202 8:61368464-61368486 CCTTGTTCTTGGACAAGAACATT 0: 1
1: 0
2: 5
3: 40
4: 508
Right 1041761207 8:61368504-61368526 CTCAGTAGCATTGGTCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041761202 Original CRISPR AATGTTCTTGTCCAAGAACA AGG (reversed) Intronic
902997611 1:20239016-20239038 AATGTTCTTGGCCAGGAGGAGGG - Intergenic
903421778 1:23222960-23222982 AGTTTTCTTGTCCAAGAAAGAGG + Intergenic
904046234 1:27610357-27610379 AATATTCTGGTCCCAGAAAAAGG + Intergenic
904315698 1:29659806-29659828 AGTCTTCTTATCCATGAACATGG + Intergenic
904704362 1:32378871-32378893 AGTGTTCTTTTCCCAGACCAAGG - Intronic
904712132 1:32438175-32438197 AATGCCCTTGGCCAAGAAGAGGG - Intergenic
907501112 1:54881809-54881831 CATGTTCCTTTGCAAGAACATGG + Intronic
908032644 1:60017675-60017697 CATGTTCCTGGCCAAGAACACGG + Intronic
908464450 1:64378162-64378184 AATTTTCCAGTCCATGAACATGG + Intergenic
909495993 1:76279361-76279383 AATTTTCTTACCAAAGAACACGG - Intronic
909551460 1:76902394-76902416 AATCTTCTTGTCCATGAACATGG - Intronic
909681204 1:78294274-78294296 AATGTTAATCTCCAAGACCATGG + Intergenic
909920174 1:81371722-81371744 ATTTTTCTTGTTCAAAAACATGG - Intronic
910825866 1:91406390-91406412 AATGTTTTTGTTTATGAACATGG - Intergenic
911156399 1:94641803-94641825 ATTGTTCTTGTCACAGAACTTGG + Intergenic
911929877 1:103888619-103888641 ATTTTTCTTATCCAAGAGCATGG - Intergenic
911934754 1:103955145-103955167 CATTTTCTTATCCATGAACAAGG + Intergenic
912752278 1:112295075-112295097 ATTCTTCCTGTCCATGAACATGG - Intergenic
913359811 1:117967750-117967772 AGTGTTCTTTTCAAAGAACAAGG - Intronic
914513041 1:148351558-148351580 GATGTCCCTGTCCAAGAGCAGGG + Intergenic
914976735 1:152371694-152371716 AGTCTTCTAGTCCATGAACAAGG - Intergenic
915806228 1:158854981-158855003 AACGTTCCTGTTCAAGATCATGG - Intergenic
916182071 1:162093954-162093976 AATGATTTTGACCAAGAAGATGG + Intronic
917027819 1:170661837-170661859 AATGTTCTTTTCCCAGATCAGGG + Intergenic
917150864 1:171943293-171943315 AATGCCCTTGGCCAAGAAGAGGG - Intronic
917551659 1:176038271-176038293 AGTCTTCTAGTCCATGAACATGG - Intronic
918539439 1:185613223-185613245 AGTTTTCTAGTCCATGAACATGG + Intergenic
918584415 1:186169217-186169239 ATTCTTCTTATCCATGAACATGG - Intronic
919071363 1:192759593-192759615 AGTCTTCCTATCCAAGAACATGG + Intergenic
919266069 1:195268002-195268024 ATTGTTTTTGTCCTAGAATATGG - Intergenic
919272565 1:195368292-195368314 AATTTTCTTATCCGTGAACATGG - Intergenic
919358738 1:196562440-196562462 AATGCTCTTGGCCAAGAGGAGGG + Intronic
919389957 1:196971030-196971052 AGTATTCTAGCCCAAGAACATGG - Intergenic
919389984 1:196971559-196971581 AGTATTCTAGCCCAAGAACATGG - Intergenic
920150602 1:203903802-203903824 AAAGTTCTTCTCCCAGAATATGG - Intergenic
920350896 1:205337318-205337340 AATGATCTTGTCCAAGCAGTCGG - Exonic
921039822 1:211419362-211419384 AGTATTCCTGTCCAAGAACATGG - Intergenic
921115420 1:212086225-212086247 AATCTTCTGGTCCATGAACTTGG + Intronic
921776063 1:219101628-219101650 AATCTTCTTGGCCAAGAGAAAGG - Intergenic
922626949 1:227057394-227057416 TATTTTCTTGTCTAAAAACATGG + Intronic
922871441 1:228905155-228905177 AATGTCCTTGTTCAAGAACAAGG + Intergenic
923619072 1:235562769-235562791 AGTCTTCTTATCCATGAACATGG + Intronic
923769823 1:236928734-236928756 AATGTCCTTGGCCAAGAGGAGGG - Intergenic
923876905 1:238059045-238059067 AATGTTAATCTCCAAGAAAATGG - Intergenic
924214256 1:241804183-241804205 AATCTTCTTACCCATGAACATGG - Intergenic
924525856 1:244847582-244847604 AATGTCCTTATTCTAGAACATGG - Intronic
924628113 1:245712417-245712439 AATCTTATGGTCCAAGAGCAGGG - Intergenic
1063154476 10:3365984-3366006 AATGTCCTTGTTCTAGAACAGGG - Intergenic
1063502229 10:6565676-6565698 AATCTCCTTGTCCAGGAACTAGG + Intronic
1064589233 10:16871585-16871607 AATGTTATTGTAAAAGATCAGGG + Intronic
1065818474 10:29503728-29503750 AGTCTTCTTATCCATGAACATGG - Intronic
1065954442 10:30680771-30680793 AGTCTTCTTATCCATGAACATGG + Intergenic
1066016880 10:31255458-31255480 AATCTTCCTATCCAAAAACATGG + Intergenic
1066505152 10:36034742-36034764 AATATTCTTGTCCAGCAACTTGG + Intergenic
1067356771 10:45535934-45535956 AATCTTCTGATCCATGAACATGG - Intronic
1067857885 10:49812690-49812712 AGTCTTCTTGTCCATGAACATGG + Intergenic
1068346564 10:55787482-55787504 AAAGTCCTTGTCCATGAACCAGG - Intergenic
1069188434 10:65458209-65458231 AATGTCCTTGTGCAAGATAAAGG - Intergenic
1071050525 10:81442739-81442761 AATTATCCTATCCAAGAACAGGG + Intergenic
1071468801 10:85964161-85964183 ATTGTTCTTATCCATGAGCATGG - Intronic
1071486176 10:86104134-86104156 CCTGTTCTTGTTAAAGAACAGGG - Intronic
1071794851 10:88993329-88993351 AAGTTTCTTGGCCAATAACAGGG - Intronic
1071808359 10:89149502-89149524 ATTCTTCTTATCCATGAACATGG + Intergenic
1072480141 10:95803172-95803194 AATCTTCCTGTCCATGAGCATGG + Intronic
1073643100 10:105272934-105272956 AAGATTCTTGGCCAAGAAAATGG + Intergenic
1073669308 10:105569804-105569826 ATTCTTCTAATCCAAGAACATGG - Intergenic
1074641142 10:115382304-115382326 ATTCTTCTTATCCATGAACATGG + Intronic
1075892658 10:125967094-125967116 AATCTAAATGTCCAAGAACATGG - Intronic
1077452493 11:2657167-2657189 AATATTCTTGAAGAAGAACAAGG - Intronic
1077739745 11:4832387-4832409 AATCTTCTTGTTCAACAACATGG + Intronic
1078241765 11:9536511-9536533 AAATTTCTTGTCCAAGAACTTGG - Intergenic
1078241770 11:9536566-9536588 CAAATTCTTGTCCAAGAACTTGG + Intergenic
1079884720 11:25972826-25972848 AATGCCCTTGGCCAAGAAGAGGG + Intergenic
1080500620 11:32867346-32867368 AATCTTCCTGTCCATGAGCATGG - Intergenic
1081010309 11:37802569-37802591 AATGTTTTTTTGCAACAACATGG + Intergenic
1081317091 11:41643359-41643381 AATTTTCTGATCCATGAACATGG + Intergenic
1081439933 11:43069032-43069054 ATTCTTCTTGTCCAAGAACATGG - Intergenic
1084339410 11:68485001-68485023 AACCTTCTTATCCATGAACATGG + Intronic
1085148953 11:74232409-74232431 AATGGTCTTATGCAAGAATATGG + Intronic
1085647430 11:78235071-78235093 AATGTTAATCTCCAAGACCATGG - Intronic
1086383314 11:86282460-86282482 AATGAACATGTCCAACAACAAGG - Intergenic
1086422352 11:86649835-86649857 ATTGTTCCTGTCCATGAGCATGG - Intronic
1086871321 11:92040716-92040738 AATGTTCTTTACAAATAACAAGG + Intergenic
1087216007 11:95495623-95495645 AATGTCCTGGGCCCAGAACAGGG - Intergenic
1087383516 11:97439591-97439613 ATTCTTCTTATCCATGAACATGG - Intergenic
1087501734 11:98964555-98964577 AAAATTCTTATCAAAGAACAAGG + Intergenic
1088707489 11:112477079-112477101 CATTTTCTTGCCCAAGCACATGG - Intergenic
1089033154 11:115354987-115355009 AGTGTTTTTGTTCAAGAAGAAGG - Intronic
1089145264 11:116324825-116324847 GCTGTCCTTGTCCAAGAAGATGG - Intergenic
1090657258 11:128855660-128855682 AACGTTCTCCTCCATGAACATGG + Intronic
1090813861 11:130273159-130273181 AATCTTCTGATCCATGAACATGG + Intronic
1091607281 12:1965097-1965119 AATCTTCTTATCCAACAACAGGG + Intronic
1092176575 12:6412450-6412472 AGTCTTCTTCTCCAGGAACATGG + Intergenic
1092304033 12:7281219-7281241 AATGCTCTTGGCTAAGAAGAAGG - Intergenic
1092397203 12:8137685-8137707 AAATTACTTGTCCAATAACAAGG + Intronic
1092633059 12:10406541-10406563 AATGGTCTTGACCAGGTACATGG + Intronic
1092663758 12:10770514-10770536 AATGTTCTTCTTCCAGAATATGG + Intergenic
1092931151 12:13317077-13317099 CAAGTTCTTGTCCCACAACAAGG - Intergenic
1093260798 12:16935296-16935318 ATTCTTCCTGTCCATGAACATGG + Intergenic
1093973884 12:25400506-25400528 AATGTTCATCCCCAAGAATATGG + Intergenic
1094145402 12:27223202-27223224 AGTCTTCCTGTCCATGAACATGG - Intergenic
1094815087 12:34175265-34175287 AATGTCCTTATCCAAGAAGAGGG - Intergenic
1095134314 12:38580187-38580209 CATGTGCCTGTCCCAGAACATGG + Intergenic
1095590598 12:43899059-43899081 AAGGTTCTTGTGCAAGGGCAGGG - Intronic
1097418780 12:59347990-59348012 ATTCTTCCTGTCCATGAACATGG + Intergenic
1098021858 12:66164260-66164282 AATGTTTTTTTCTAAGAAAATGG - Intronic
1098238689 12:68443340-68443362 AATGTTAATACCCAAGAACATGG - Intergenic
1098878304 12:75890338-75890360 AATTCTCTTGTCCACAAACAAGG + Intergenic
1099168911 12:79340285-79340307 ATTCTTCCTGTCCATGAACATGG + Intronic
1100009769 12:89939236-89939258 AATGTTCTTGACCAAAATGAGGG - Intergenic
1100266652 12:92983234-92983256 AATCTTCTTATCCATGAGCATGG - Intergenic
1101100487 12:101386825-101386847 AATCTTCCTAGCCAAGAACATGG - Intergenic
1101149704 12:101873395-101873417 AAAGTTCTTCTCCCAGAATATGG - Intergenic
1101692711 12:107096585-107096607 AATGTTATTCTCCAAGACAATGG + Intergenic
1103047151 12:117745957-117745979 ATTCTTCCTGTCCATGAACATGG - Intronic
1103475752 12:121217397-121217419 ATTGTTTTAGTCCAAGAAAACGG + Intronic
1104084033 12:125458222-125458244 AAGGCCCTTGTCCAAGGACAAGG + Intronic
1105274950 13:18912313-18912335 ATTCTTCTTATCCACGAACATGG - Intergenic
1105698352 13:22913312-22913334 AGTCTTCCTGTCCATGAACATGG - Intergenic
1105706646 13:22971486-22971508 AATGTCCTTGTAAGAGAACATGG - Intergenic
1105717343 13:23080712-23080734 TATCTTCTTGTCCAAGGAGATGG - Intergenic
1106045756 13:26139661-26139683 ACTCTTCCTGTCCAAGAAAATGG + Intronic
1106642469 13:31598816-31598838 AAGGTCCTTGTCTAAGAGCATGG - Intergenic
1106730387 13:32535775-32535797 AATGTTGTTTTCCCAGAACCAGG + Intronic
1108452847 13:50584869-50584891 AATTTACTTATCCATGAACAAGG + Intronic
1108800348 13:54087719-54087741 AATCTTCTTATCCATGAGCATGG + Intergenic
1109386755 13:61639415-61639437 AGTCTTCTTATCCAAGAACATGG + Intergenic
1109459285 13:62633868-62633890 AATCTTCCTATCCATGAACATGG - Intergenic
1109676620 13:65684558-65684580 AATCTTCCTGTTCATGAACATGG + Intergenic
1110052497 13:70922343-70922365 AATTTTCATGGCCAGGAACAGGG + Intergenic
1110453175 13:75660086-75660108 AATGTTCTTGTAAAACAACTCGG + Intronic
1110503083 13:76251847-76251869 ATTATTTTTATCCAAGAACAAGG + Intergenic
1111622090 13:90737285-90737307 AATCTTCCTATCCATGAACATGG - Intergenic
1112859089 13:103808361-103808383 AATGTTAATGGCCAAGAAAATGG + Intergenic
1113568126 13:111332163-111332185 AGTGTTCTGGTCCATGAACAGGG + Intronic
1113584355 13:111453946-111453968 AATCTTCTGATCCATGAACATGG - Intergenic
1115182488 14:30645446-30645468 AGTCTTCTTATCCATGAACATGG + Intronic
1115413840 14:33107822-33107844 AATGTTGTTTGCCAGGAACATGG + Intronic
1116081005 14:40172044-40172066 AATCTTCTAATCCATGAACATGG + Intergenic
1116415582 14:44673073-44673095 AATGTTCTTCTCCAAGATAATGG - Intergenic
1116429069 14:44824990-44825012 AATCTTCCTGTCCATGAGCATGG - Intergenic
1117369040 14:55059078-55059100 AATCATCTCGTTCAAGAACAAGG - Intronic
1118193390 14:63601713-63601735 AAAGTTCTTCTCCCATAACATGG + Intronic
1118313843 14:64712441-64712463 AATGTTCCATTCCATGAACAAGG + Intronic
1118516572 14:66535577-66535599 AGTCTTCTAGTCCATGAACATGG + Intronic
1119762768 14:77163928-77163950 AATCTTCAGGTCCAAGAATATGG - Intronic
1120166592 14:81208073-81208095 AATGTTAATCTCCAAGACCATGG + Intronic
1121094957 14:91211208-91211230 AGTCTTCTTATCCATGAACATGG - Intronic
1121425023 14:93844421-93844443 AATGCCCTTGTCCAAGAGGAGGG + Intergenic
1122850004 14:104522961-104522983 AATGTCCTTGTAAGAGAACATGG - Intronic
1123672782 15:22676913-22676935 AATCTTCCTACCCAAGAACATGG + Intergenic
1124008850 15:25818480-25818502 ATTATTCTGGTCCACGAACATGG - Intronic
1124064227 15:26324884-26324906 AATGCCCTTGGCCAAGAAGAAGG - Intergenic
1124139605 15:27065548-27065570 AATGTTCTGGTCCAAACCCAGGG - Intronic
1124148407 15:27153592-27153614 AATCTTCTAATCCATGAACATGG + Intronic
1124528687 15:30483227-30483249 AATCTTCCTACCCAAGAACATGG + Intergenic
1124769969 15:32524470-32524492 AATCTTCCTACCCAAGAACATGG - Intergenic
1126129665 15:45327940-45327962 AATGCCCTTGGCCAAGAAGAGGG - Intergenic
1127747550 15:61995408-61995430 AATGTTCTTGCCCTTGAGCATGG + Intronic
1130034587 15:80345954-80345976 AATGTCCATGACCAAGACCATGG + Intronic
1130318790 15:82821818-82821840 AATCTTCCTACCCAAGAACATGG + Intronic
1130568214 15:85016770-85016792 TATCTTCTTATACAAGAACATGG + Intronic
1130652382 15:85769379-85769401 AAGGTTCTTCTCCAGGAACTCGG + Exonic
1131227228 15:90634932-90634954 AAAGTTCTTCTCCCAGAATATGG + Intronic
1131910171 15:97190156-97190178 AATCTTCTTACCCAGGAACAAGG + Intergenic
1133029270 16:3001936-3001958 AGTGTTCTTTTCCATGCACAAGG - Intergenic
1133098171 16:3461812-3461834 AATATTCTTGGCCAGGCACAGGG + Intronic
1133193036 16:4148321-4148343 AATTTTCTAATCCATGAACATGG - Intergenic
1133404883 16:5515471-5515493 AATCTCCTTGTCCAACAAAATGG + Intergenic
1134413804 16:14025998-14026020 AATCTTCTAGTCCATGAACATGG - Intergenic
1135431856 16:22391307-22391329 AATCTTCTGATCCATGAACATGG + Intronic
1138159955 16:54744353-54744375 CATTTTTTTGTCCAATAACAGGG + Intergenic
1138557055 16:57777223-57777245 AATCTTCTAATCCATGAACATGG - Intronic
1138792447 16:59922050-59922072 AATGCTCTTGTCCAGGGACATGG - Intergenic
1139807693 16:69582980-69583002 AATATTTTTGTCCATGAACATGG + Intronic
1140047493 16:71451649-71451671 ACAGTTCTAGTCCAAGATCAAGG - Intronic
1140394122 16:74612672-74612694 AAAGTTCTTCTCCCAGAACATGG - Intergenic
1140726071 16:77813772-77813794 AATGAGCTGGTCCAAGAACTGGG - Intronic
1142287785 16:89178461-89178483 ACTCTTCTTCTCCCAGAACAGGG - Intronic
1142439775 16:90089423-90089445 AACGTTTTTATCCAAGAAGAGGG + Intronic
1142745338 17:1954097-1954119 AAACTTCTTGTCATAGAACATGG + Intronic
1144258312 17:13491801-13491823 AATTTTCCTATCCATGAACATGG + Intergenic
1144417359 17:15062945-15062967 AATCTTCTCATCCATGAACATGG - Intergenic
1144570755 17:16397081-16397103 AATGTCCTTAGCCAAGAAGAGGG - Intergenic
1145362889 17:22226855-22226877 AATGTCCTTAGCCAAGAAGAGGG - Intergenic
1145847349 17:28052519-28052541 AAAGCTCTTGTCCAAGAGGAAGG + Intronic
1146205270 17:30899080-30899102 TGTGTTCTTTTCCAATAACATGG + Exonic
1146739641 17:35271611-35271633 AATCTTCTTATCCAAAAACGTGG - Exonic
1148376496 17:47151805-47151827 AAAGTTCTGGTCCACAAACAAGG - Exonic
1149000763 17:51755155-51755177 ACTTTTCTTGTTAAAGAACAAGG + Intronic
1151434657 17:74087413-74087435 AATGTTCTCTTCCCAGAATAGGG + Intergenic
1151861689 17:76768593-76768615 AATTTTCTTTTCCTAGAAAAAGG + Intronic
1152872078 17:82760355-82760377 AATTTTCATGTCTAAGATCATGG + Intronic
1152957788 18:54136-54158 AATGTCCTTATCCAAGAAGAGGG - Intronic
1153182139 18:2446843-2446865 AATCTTCTTGGCCAAGAGGAAGG + Intergenic
1153410555 18:4788258-4788280 AGTCTTCTTATCCATGAACATGG - Intergenic
1154313212 18:13283197-13283219 AATGTTAATCTCCAAGACCATGG - Intronic
1155013715 18:21810268-21810290 AATTTTCTAATCCATGAACATGG - Intronic
1155069823 18:22305122-22305144 CATGATCTTGTCCAATATCATGG - Intergenic
1155106511 18:22671527-22671549 ATTGTTCTGTCCCAAGAACAAGG - Intergenic
1155227582 18:23742568-23742590 CATGTTATCTTCCAAGAACATGG - Intronic
1155227824 18:23745091-23745113 CATGTTATCTTCCAAGAACATGG - Intronic
1156699680 18:39810559-39810581 ATTCTTCTTATCCAAGATCATGG + Intergenic
1158120083 18:54039238-54039260 AATGATCTTGTCCATGAAATTGG - Intergenic
1158791909 18:60791056-60791078 AATCTTTTTGTCCATGAACATGG + Intergenic
1158792506 18:60798787-60798809 ACTCTTCCTGTCCATGAACATGG + Intergenic
1158920272 18:62184888-62184910 AATGTTCTTGTCCCAGTGCCTGG - Intronic
1159485281 18:69047908-69047930 ATTCTTCCTGTCCATGAACATGG - Intronic
1162643769 19:12034077-12034099 TAAGATCTTGGCCAAGAACATGG + Intronic
1163397438 19:17072052-17072074 ACAATTCTTGTCCAAGAACGAGG + Intronic
1164446772 19:28324383-28324405 AATGCTCTTGGCCAAGAGGAAGG - Intergenic
1164665597 19:30032372-30032394 AATCTTCCTGTCCATGAACATGG + Intergenic
1164753173 19:30670900-30670922 AATGTTCTTGGCCATGAAATGGG - Intronic
1166022800 19:40048368-40048390 AATGATATTGTTCAAGAACCAGG - Intronic
1166575937 19:43837840-43837862 AAAGTTCCTTTCCAACAACAGGG - Intronic
1167187918 19:47960480-47960502 AATCTTCCAGTCCATGAACACGG - Intergenic
1167461590 19:49627485-49627507 AACATTCTTGTTCTAGAACACGG - Intergenic
924966119 2:77708-77730 AATGTTCATCACCAAGAAAATGG - Intergenic
925467179 2:4116917-4116939 ATTCTTCTTGTCCATGAGCATGG + Intergenic
925784206 2:7413390-7413412 AGTCTTCTTATCCATGAACATGG + Intergenic
926636053 2:15181063-15181085 AATATTCTTGCCCAAAAGCAAGG - Intronic
927126536 2:20016950-20016972 AATTTTTTTCTCCAAGTACATGG - Intergenic
927605558 2:24483649-24483671 AATGTTAATCTCCAAGACCATGG + Intergenic
929118822 2:38467067-38467089 AATGTTTTTTACCCAGAACACGG + Intergenic
929312448 2:40441299-40441321 ATTGTTCCTATCCATGAACATGG - Intronic
930207580 2:48603357-48603379 AATGTTCTCTTCCTAGTACAGGG + Intronic
930263555 2:49174196-49174218 AATATTTTTGTCCAAAATCATGG - Intergenic
930503765 2:52256027-52256049 AATGTTAATCTCCAAGACCACGG - Intergenic
930746553 2:54889410-54889432 AGTTTTCCTTTCCAAGAACATGG + Intronic
931100172 2:58990257-58990279 AATTTTCCTATCCATGAACATGG - Intergenic
931373596 2:61687578-61687600 AATCTTGTAATCCAAGAACATGG - Intergenic
931551601 2:63452468-63452490 ATTCTTCCTGTCCATGAACATGG - Intronic
932101477 2:68904374-68904396 ATTGTTCTAATCCATGAACATGG - Intergenic
932821687 2:74906732-74906754 AATGTTAATCCCCAAGAACATGG - Intergenic
933681868 2:85109080-85109102 AATCTTCCTATCCAAGAACACGG + Intergenic
934681874 2:96289835-96289857 ATTGTTCTTGTCCAGCATCAGGG + Exonic
935001705 2:99023998-99024020 AGTGTTCTGGCCCATGAACATGG + Intronic
935559784 2:104548131-104548153 AATCTTCTTGTCCTAAACCAGGG - Intergenic
936481183 2:112886285-112886307 AATGCTCTTGGCCAAGAAGAGGG - Intergenic
936499607 2:113055464-113055486 AATGTTTTTCACCAAGAAAATGG - Intergenic
937172294 2:119886799-119886821 AATGTTCCTCTCCCAGAACATGG - Intronic
938151301 2:128886479-128886501 ATTGTTCTAATCCATGAACATGG + Intergenic
938686446 2:133742498-133742520 AATGTTAATCTCCAAGATCATGG - Intergenic
939760195 2:146166174-146166196 AAGGTTCTTGTTCAAGCATAGGG - Intergenic
939977397 2:148733986-148734008 ACTTTTCTTTTCCAAGAAAATGG + Intronic
940408730 2:153335765-153335787 AATGTTAATCTCCAAGACCATGG + Intergenic
940790830 2:158028083-158028105 AATGTTAATCTCCAAGAAAATGG - Intronic
941049000 2:160710291-160710313 AATCTTCTTATCCATGAACTTGG + Intergenic
941212494 2:162658586-162658608 AATCTTCCTGTCTATGAACATGG + Intronic
941242595 2:163058128-163058150 AATCTTCCTATCCATGAACATGG + Intergenic
941515645 2:166472859-166472881 AATTTTCTTTTACAGGAACATGG + Intronic
942475658 2:176317316-176317338 AAAGTTCTTGTGCAAGTACTTGG + Intronic
942573276 2:177335564-177335586 AGTGTTCTTATCCAAGAACATGG - Intronic
943072266 2:183154242-183154264 AATGTTAATGCCCAAGAGCATGG - Intronic
943106425 2:183549504-183549526 ATTCTTCTTATCCATGAACATGG - Intergenic
943395771 2:187330701-187330723 AATCTTCTTATTCAAGAACATGG + Intergenic
944242942 2:197503078-197503100 AAAGTTCTTCTCCCAGAATATGG + Exonic
944541237 2:200755682-200755704 AATGTTCCTGTCCTCCAACATGG - Intergenic
944569403 2:201028338-201028360 ACTCTTCCTGTCCATGAACATGG - Intronic
944998276 2:205319324-205319346 AGTGCTCTAGTCTAAGAACATGG - Intronic
947040274 2:225910676-225910698 AACATCCTTGTCCAAGAGCAAGG + Intergenic
947784340 2:232801891-232801913 AATCTTCCAGTCCATGAACATGG + Intronic
947858666 2:233342556-233342578 ATTGTCCCTGTCCAAGAGCAAGG - Intronic
948397558 2:237658311-237658333 AGTCATCTTATCCAAGAACATGG - Intronic
948412801 2:237777445-237777467 AATACTACTGTCCAAGAACAAGG - Intronic
948780174 2:240315815-240315837 AATGTTCCAATCCATGAACATGG - Intergenic
948995900 2:241578401-241578423 AGTTTTCTTATCCAGGAACATGG - Intergenic
1168922121 20:1547759-1547781 AATCTTCTGGTCCATGAAAATGG + Intronic
1169389954 20:5182103-5182125 AATGTTTTATTCCTAGAACATGG - Intronic
1169504515 20:6194210-6194232 AATGTTCAAGTCCAAGCACTTGG + Intergenic
1170494223 20:16909046-16909068 ATTCTTCTTATCCATGAACATGG + Intergenic
1171415336 20:24975548-24975570 AGTATTCCTGTCCATGAACATGG - Intronic
1171512761 20:25699414-25699436 ATTCTTCTAGTCCAAAAACACGG + Intergenic
1171725282 20:28612778-28612800 ATTCTTCTAGTCCATGAACATGG + Intergenic
1171776873 20:29376794-29376816 AGTGTCCTTATCCAAGAAGAGGG - Intergenic
1171789476 20:29507262-29507284 ATTCTTCTAGTCCATGAACATGG + Intergenic
1171858057 20:30367180-30367202 ATTCTTCTAGTCCATGAACATGG - Intergenic
1172051202 20:32120256-32120278 AGTCTTCTAGTCCATGAACATGG + Intronic
1172089515 20:32419154-32419176 AATCTTCTTAATCAAGAACATGG + Intronic
1172566965 20:35938289-35938311 AATGCTCTTGGCCAAGAGGAGGG + Intronic
1173547822 20:43913006-43913028 AAACTTCTTATCCATGAACATGG - Intergenic
1173697856 20:45036583-45036605 AAAGTTCTTGACCAAAAATAAGG + Intronic
1174950980 20:55041424-55041446 AATGTTAATCCCCAAGAACATGG + Intergenic
1175384812 20:58587365-58587387 AATGTTGTTGTCAATGACCACGG - Intergenic
1176807949 21:13509013-13509035 ATTCTTCTTATCCAGGAACAGGG + Intergenic
1177259424 21:18710909-18710931 ACTCTTCCTATCCAAGAACATGG - Intergenic
1178266165 21:31144329-31144351 AATATTCTCGTCCAAAAATATGG + Intronic
1179874275 21:44259873-44259895 AATCTTCTGATCCATGAACATGG - Intronic
1180887337 22:19256048-19256070 AGTGTTCTGATCCATGAACATGG - Intronic
1183000442 22:34853348-34853370 AATCTTCCAGTCCATGAACATGG - Intergenic
1183424396 22:37731312-37731334 AATTTTTTTTTCCTAGAACAAGG + Intronic
1184763537 22:46559356-46559378 ATTGTTCTAGTCCACGAACATGG - Intergenic
1184888273 22:47361603-47361625 AATCTTCTTATTCATGAACAAGG + Intergenic
949319360 3:2791588-2791610 ATTCTTCTTGTCCATGAACTTGG - Intronic
950700755 3:14743991-14744013 AATGTTAATTTCCAAGACCATGG - Intronic
950715852 3:14847345-14847367 AGTGTTTTTGTCCGAGATCATGG + Intronic
950922513 3:16708935-16708957 CATGTTCTTTGCCAGGAACATGG - Intergenic
951186088 3:19714837-19714859 ACAGCTCTTCTCCAAGAACATGG + Intergenic
951378331 3:21951161-21951183 ATTCTTCCTGTCCATGAACATGG + Intronic
951759620 3:26130816-26130838 AATGATCTTGTAAAAGAAGAGGG - Intergenic
951773799 3:26286424-26286446 AATGTTCTTGCCCCAGAGAAGGG - Intergenic
952569721 3:34700337-34700359 CATGTTCTTTTGCAGGAACATGG + Intergenic
952838115 3:37621463-37621485 CATGCTCTTGTCCAAAAGCATGG - Intronic
953857436 3:46510452-46510474 AATCTTCCTATCCAAGAACATGG + Intergenic
956150719 3:66239381-66239403 ATTTTTCTTTTCCCAGAACAGGG + Intronic
956988677 3:74735989-74736011 AGTCTTCTGGTCCATGAACATGG + Intergenic
957088212 3:75702860-75702882 AATGTCCTTATCCAAGAAGAGGG + Intergenic
957580842 3:82070901-82070923 AATGTTCTTTTCCAACAAATAGG - Intergenic
957765794 3:84622118-84622140 AATGTTATTGACCAAGATAATGG - Intergenic
958700586 3:97583662-97583684 AGTCTTCTTATCCATGAACATGG - Intronic
959046673 3:101482440-101482462 ACTCTTCTTATCCATGAACATGG - Intronic
960496677 3:118383819-118383841 AATGTTAATTTCCAAGACCATGG + Intergenic
960808749 3:121608826-121608848 GATGTTCTTGTCCAAAAATTGGG - Intronic
961123035 3:124390140-124390162 ATTCTTTTTGTCCAGGAACATGG + Intronic
962294283 3:134167167-134167189 ATTGTTCCTGTCCATGAGCATGG - Intronic
962440253 3:135406614-135406636 AATGTTAATCTCCAAGACCAGGG - Intergenic
962539005 3:136359268-136359290 AATGAACTTGTTCAAGAGCAAGG - Exonic
962656551 3:137550024-137550046 AGTCTTCTTTTCCAAGAACATGG + Intergenic
962690616 3:137894132-137894154 AAGGTTCTTATCCAAAAGCATGG + Intergenic
963859131 3:150289175-150289197 AGTCTTCTTATCCATGAACATGG - Intergenic
964057597 3:152480249-152480271 ATTCTTCTTGTCCATGAGCATGG + Intergenic
964836100 3:160940349-160940371 AATGTTCATCCCCAAGACCATGG + Intronic
965553453 3:169995137-169995159 AATATTCTTGTACCAGAGCATGG + Exonic
965560075 3:170053249-170053271 AATCTTCTTATCCATGAACATGG + Intronic
965662334 3:171054540-171054562 ATTGTTATTGTCATAGAACATGG + Intergenic
965793032 3:172410507-172410529 ATTCTTCTTGGCCAAGAACTTGG - Intergenic
966299369 3:178461698-178461720 AATGTTAATCTCCAAGACCATGG + Intronic
966604748 3:181811053-181811075 AAAGTTGTTGTTGAAGAACAGGG - Intergenic
967054259 3:185814662-185814684 TATGTTCTTGTCAAAAAGCATGG + Intronic
968356948 3:198116053-198116075 AATGTCCTTACCCAAGAAGAGGG + Intergenic
969629357 4:8326851-8326873 AATCTTCCTATCCATGAACATGG + Intergenic
969665032 4:8552533-8552555 AAGGCTGATGTCCAAGAACAGGG - Intergenic
970248984 4:14094170-14094192 AGTGTTCTTATCCATAAACAGGG - Intergenic
970554278 4:17215460-17215482 AATGTTCTTCCCCAAGACAATGG - Intergenic
971116811 4:23657916-23657938 AATGTTTTTGTCAAAGAAGGTGG - Intergenic
971362419 4:25950402-25950424 AATGATCCTCTCCAAGCACAAGG + Intergenic
971512430 4:27443577-27443599 AATATTCTTATCCAATAAGAAGG + Intergenic
973709220 4:53611347-53611369 AATTTTCCTATCCAAGAAAATGG - Intronic
973937230 4:55859244-55859266 AATCTTTGTGTCCATGAACATGG + Intronic
974281499 4:59800872-59800894 ATTCTTCTTGTCCATGAGCATGG + Intergenic
974718170 4:65698706-65698728 ATTATTCTTGTCAAAGATCAGGG + Intergenic
975186458 4:71409721-71409743 AATGTTATTCCCCAAGACCATGG + Intronic
975672963 4:76800409-76800431 ATTGATCTAGTCCATGAACATGG - Intergenic
977063854 4:92288628-92288650 AATGTTGATCTCCAAGACCATGG - Intergenic
977611481 4:99037920-99037942 AGTCTTCCTGTCCAGGAACAGGG + Intronic
977977688 4:103286478-103286500 AATGTTAATTTCCAAGAAAATGG + Intergenic
978076430 4:104536537-104536559 ATTATTCTAGTCCATGAACATGG + Intergenic
978391621 4:108232563-108232585 GATTTTCCTATCCAAGAACATGG + Intergenic
978475266 4:109120977-109120999 AATATTCCTGTCCATGAATATGG - Intronic
978659819 4:111111755-111111777 AATGTATTTGTCAAAAAACAAGG + Intergenic
979045410 4:115856700-115856722 ATTCTTCTTGTCCATGAGCATGG - Intergenic
979564618 4:122140321-122140343 ATTCTTCTTATCCATGAACATGG + Intergenic
979948019 4:126859202-126859224 AATGGTGTTGACCAAGAGCAGGG + Intergenic
979950441 4:126886231-126886253 AATGTTCCTGACTAAGAAAAGGG - Intergenic
980398348 4:132245839-132245861 AATGGTCTTGTCAATGAGCATGG + Intergenic
980525739 4:133989188-133989210 AATGTTATTCACCAACAACATGG - Intergenic
981094541 4:140764761-140764783 TATCTTTTTGTCCAAGATCAAGG + Intergenic
981955965 4:150474603-150474625 AATCTTCTGATCCATGAACATGG + Intronic
982146444 4:152399832-152399854 AGTCTTCCTGTGCAAGAACATGG - Intronic
982559419 4:156912133-156912155 AATATTCTAGTACAAAAACAGGG + Intronic
982826176 4:160006509-160006531 ATTGTTCCTATCCATGAACATGG - Intergenic
982829615 4:160043521-160043543 AATGTTAATCCCCAAGAACATGG - Intergenic
982966308 4:161913215-161913237 AATGTTAATCTCCAAGACCATGG + Intronic
983732642 4:171014668-171014690 AAGGTTTTAGTCCAATAACAGGG - Intergenic
984017382 4:174442052-174442074 AATGTTAATTTCCAAGACCATGG - Intergenic
984602814 4:181748252-181748274 AATCTTCTTATCCAAGTGCATGG + Intergenic
984956157 4:185047816-185047838 GGTGTTATTGTCCAAGAACGGGG - Intergenic
986172029 5:5322624-5322646 ATTGTTCTTATCCATGAGCATGG + Intergenic
986620777 5:9671665-9671687 ATAGTTCCTGTCCATGAACATGG - Intronic
986627086 5:9732264-9732286 AATGCTCTGCTCCAAGAACTCGG - Intergenic
986825470 5:11516696-11516718 ACTTTTCTTGTCCATGAACATGG - Intronic
987661027 5:20876311-20876333 ATTCTTCTTGTCCACGATCATGG - Intergenic
987894402 5:23925891-23925913 AATGTTAATGCCCAAGACCATGG - Intergenic
988735559 5:34017191-34017213 AAAGTTCCTTTCCAAAAACACGG - Intronic
988762614 5:34329379-34329401 ATTCTTCTTGTCCACGATCATGG + Intergenic
988820392 5:34878394-34878416 AGTCTTCTTATCCATGAACATGG - Intronic
988925404 5:35985234-35985256 ATTCTTCTAGTCCATGAACAAGG - Intronic
989085726 5:37673922-37673944 AATGTCCTTTTGCAAGGACATGG - Intronic
989389130 5:40882373-40882395 AATGTTAATCCCCAAGAACATGG + Intergenic
990226193 5:53657388-53657410 AATGTTCTGGTCACAGACCATGG - Intronic
990604052 5:57390210-57390232 AATCTTCCTTTCCATGAACATGG + Intergenic
990849352 5:60184171-60184193 AATGTTTTCCTCCAAGAATAGGG + Intronic
991025266 5:62022525-62022547 AATCTTCCTTTCCAGGAACATGG - Intergenic
991514776 5:67423087-67423109 AATGTTCTTGTACACTAACAAGG + Intergenic
991539829 5:67715369-67715391 AATTTGATTGTCCAAGAAAAAGG + Intergenic
992927091 5:81599334-81599356 AATGTTTTTATCAAAGAATAGGG - Intronic
993263923 5:85697101-85697123 ATTCTTCCTATCCAAGAACATGG - Intergenic
993587511 5:89748462-89748484 AGTCTTCTAGTTCAAGAACATGG + Intergenic
994217480 5:97154371-97154393 ATTTTTCTAGTCCATGAACATGG + Intronic
994327850 5:98469701-98469723 AATATTCCTGTCCACGAGCATGG - Intergenic
995145126 5:108779406-108779428 ACTCTTCTTGTCCATGAACATGG + Intronic
995671915 5:114614538-114614560 AATCTTCATATCCATGAACATGG - Intergenic
995911881 5:117197601-117197623 ATTCTTCTTATCCATGAACATGG + Intergenic
996076475 5:119200685-119200707 ATTCTTCTTCTCCATGAACATGG + Intronic
996223683 5:120963692-120963714 ATTCTTCTTGTCCATGAGCATGG - Intergenic
996600848 5:125261702-125261724 AATATTCTCCTCCATGAACATGG - Intergenic
996617340 5:125457702-125457724 AATGTTCATCCCCAAGACCATGG + Intergenic
996669750 5:126103253-126103275 AATTTTCTAATCCATGAACATGG - Intergenic
996733475 5:126737808-126737830 AAAGTTCTTCTTCAAGAATATGG - Intergenic
996779305 5:127167892-127167914 AGTTTTTCTGTCCAAGAACAAGG - Intergenic
999477924 5:151918375-151918397 AATGCACTTGTCCACGGACAAGG - Intronic
999680050 5:154048908-154048930 AATGTTCTTGCCCATGAAGGAGG + Intronic
1000156020 5:158552635-158552657 AAGGTGCTTGTGCTAGAACATGG - Intergenic
1000200130 5:159001162-159001184 AATGTTTTTGTTTCAGAACATGG + Intronic
1000720278 5:164697441-164697463 AATCTTCCTGTCCATGAGCATGG - Intergenic
1000728558 5:164802189-164802211 AATGTTAATCTCCAAGAAAATGG - Intergenic
1000957944 5:167564282-167564304 AAGGTTCTTCTTCATGAACATGG - Intronic
1001462627 5:171931050-171931072 AATCTTCCTTTCCATGAACATGG - Intronic
1002260282 5:177988695-177988717 AATTTTCTTATCCAAACACAAGG - Intergenic
1002610003 5:180411056-180411078 AATCTTTCTGTCCATGAACATGG - Intergenic
1002822367 6:737347-737369 AATGTTCTTGTTCTATAACGGGG + Intergenic
1004605107 6:17187114-17187136 AATCTTCTAATCCATGAACATGG + Intergenic
1005906992 6:30270651-30270673 ATTCTTCTGATCCAAGAACAAGG - Intergenic
1007145874 6:39630305-39630327 AGTCTTCTTATCCATGAACATGG + Intronic
1007387101 6:41527688-41527710 AATGGTCTTTCCCCAGAACAGGG + Intergenic
1008756073 6:54797014-54797036 AATGTTAATCTCCAAGACCATGG + Intergenic
1010722537 6:79300189-79300211 AATGTTCTTTTCCTGGTACAGGG + Intergenic
1011094661 6:83646804-83646826 AACCTTCTTATCCATGAACATGG + Intronic
1012181911 6:96164755-96164777 AATGTCCTTGTCCAAGAGGAGGG + Intronic
1012205812 6:96459001-96459023 AATGCTCTTGGCCAAGAGGAGGG + Intergenic
1013351035 6:109305945-109305967 AATGTTCTTCTACCAAAACATGG - Intergenic
1014159224 6:118148039-118148061 AAGAATCTTGTCAAAGAACATGG + Intronic
1014385275 6:120792974-120792996 AATGTTCCTGTCCCTGAGCATGG + Intergenic
1014443022 6:121495067-121495089 AATGTCCTTACCCCAGAACAAGG - Intergenic
1014576720 6:123082485-123082507 AATGTTAATCTCCAAGACCATGG - Intergenic
1014701144 6:124690067-124690089 AATAATCTTATCCATGAACATGG + Intronic
1014989753 6:128059252-128059274 AATCTTCTAATCCATGAACATGG + Intronic
1015461156 6:133492977-133492999 ATTCTTCTAGTCCATGAACATGG - Intronic
1016565117 6:145443345-145443367 ATTCTTCTTATCCAAGAGCAGGG + Intergenic
1016591349 6:145747812-145747834 AATTTTCTGTTCCATGAACATGG - Intergenic
1017397671 6:154021572-154021594 AGTCTTCTTATCCAAAAACATGG + Intronic
1018071968 6:160172790-160172812 AATGTTTTTGCCAAAGAGCAAGG + Intronic
1019022914 6:168933614-168933636 AATCTTTTTATCCATGAACATGG + Intergenic
1019818639 7:3221397-3221419 AGTCATCTTGTCCAAGAACAAGG - Intergenic
1019823266 7:3262105-3262127 AATGCTCTTGGCCAAGAGGAGGG + Intergenic
1020554906 7:9658731-9658753 AATGTTCTGTTTTAAGAACAGGG + Intergenic
1020935845 7:14462617-14462639 ATTCTTCCTGTCCAAGAGCATGG - Intronic
1021099379 7:16571221-16571243 AATGCTCTTGGCCAAGAGGAAGG - Intronic
1021776776 7:24061919-24061941 ATTCTTCTTATCCATGAACATGG - Intergenic
1021805591 7:24351491-24351513 AATTTTCTTATCTTAGAACATGG - Intergenic
1022182491 7:27935341-27935363 AATGTTCTTGTGTATGAATATGG - Intronic
1022487073 7:30787299-30787321 AATGTCCTTCTCCAACAAGAAGG - Intronic
1024032440 7:45474335-45474357 AATCTTCTTAACCATGAACATGG - Intergenic
1024340785 7:48256923-48256945 ATTCTTCTTATCCATGAACATGG + Intronic
1026776909 7:73236070-73236092 CCTGTTCTTGGCCAAGACCAGGG - Intergenic
1027017758 7:74789440-74789462 CCTGTTCTTGGCCAAGACCAGGG - Intergenic
1027070264 7:75156492-75156514 CCTGTTCTTGGCCAAGACCAGGG + Intergenic
1027398415 7:77782247-77782269 ATTGTTCTGGTCCAAGAAACTGG - Exonic
1027545158 7:79518608-79518630 AAGGTTTTTGTTCAAGAACATGG - Intergenic
1027581787 7:80005793-80005815 GATGTTCTTGTCCAGGTTCATGG - Intergenic
1027712015 7:81616130-81616152 AATGGTCATTTCCAAGAACTTGG - Intergenic
1028813452 7:95116597-95116619 AGCCTTCTTGTCCAAGAATATGG - Intronic
1029475811 7:100783899-100783921 AACCTTCTTATCCATGAACATGG + Intronic
1029779996 7:102722237-102722259 ATTCTTCTTGTCCATGAGCATGG + Intergenic
1029907803 7:104109325-104109347 ATTCTTCCTATCCAAGAACATGG + Intergenic
1030068637 7:105679629-105679651 ACTGTCCTTGGCCAAGATCAGGG - Intronic
1030754728 7:113273388-113273410 AATGTTAATATCCAAGAAAATGG - Intergenic
1030835615 7:114280909-114280931 AATGATATTTTCCAAGGACAAGG - Intronic
1031055943 7:116992644-116992666 AATGTTCATCTCCAAGACAATGG - Intronic
1031182367 7:118434532-118434554 ATTATTCTTATCCATGAACATGG + Intergenic
1031301564 7:120067822-120067844 AATGTTAATCTCCAAGAAAATGG + Intergenic
1031619808 7:123922627-123922649 AATGTTCTCTTCCTAAAACAGGG + Intergenic
1031784371 7:126010363-126010385 ATTCTTCCTGTCCATGAACATGG + Intergenic
1032476399 7:132214231-132214253 ACTGTTCTTGTCCAAGACATGGG + Intronic
1033006014 7:137563817-137563839 AATGTTCCAATCCATGAACATGG - Intronic
1033577224 7:142697058-142697080 AATGCTCTTGGCCAAGAGAAGGG + Intergenic
1033635442 7:143207765-143207787 AATGCTCTTGGCCAAGAGAAGGG + Intergenic
1035069784 7:156134945-156134967 AGTCTTCCTGTCCAGGAACATGG + Intergenic
1037670092 8:21007525-21007547 AATGCCCTTGGCCAAGAGCAGGG - Intergenic
1038196898 8:25376644-25376666 AATTTTCTTATCCAAAAGCATGG + Intronic
1039107465 8:34004569-34004591 AATGTTAATTTCCAAGAAAATGG - Intergenic
1039252783 8:35684850-35684872 AATGTTCTATTCTAAGAACTTGG - Intronic
1039705540 8:40003084-40003106 AGTTTTCCTGTCCATGAACATGG + Intronic
1041038828 8:53825133-53825155 AATTTTTCTGTCCAAGGACAAGG - Intronic
1041074922 8:54160869-54160891 AATGTTAATCTCCAAGACCATGG + Intergenic
1041140317 8:54811137-54811159 TATGTGCTTGTTCAAGATCAGGG - Intergenic
1041563754 8:59251059-59251081 ATTCTTCTGGTCCAAGAGCATGG + Intergenic
1041761202 8:61368464-61368486 AATGTTCTTGTCCAAGAACAAGG - Intronic
1042597135 8:70461835-70461857 ATTGTTCCTATCCATGAACATGG + Intergenic
1044031387 8:87241962-87241984 AATGTTCTTGGCTAAGACGAGGG - Intronic
1044789316 8:95831005-95831027 AGTTTTCCTGTCCATGAACATGG - Intergenic
1045909155 8:107385246-107385268 AAATTTCTTATCCATGAACATGG + Intronic
1046283687 8:112067803-112067825 AATGTTGTTGCCTAGGAACAGGG - Intergenic
1046284352 8:112075162-112075184 AATATTCTTTTGCAACAACATGG - Intergenic
1046520248 8:115316789-115316811 AATGTTCTCATCCAAGAACATGG - Intergenic
1047355062 8:124112454-124112476 AATGTGCTTCACGAAGAACATGG - Intronic
1047390580 8:124447433-124447455 AATGTTCTTGTCTAGAAACAGGG - Intergenic
1047564575 8:126029242-126029264 AATGTTCTGGCCCAAGGATATGG - Intergenic
1049390412 8:142365910-142365932 AGTGTTCCTGTCCATGAACATGG - Intronic
1049701853 8:144018689-144018711 AATGTTCTTCTCTGAGAGCAAGG + Intronic
1050215833 9:3322227-3322249 AAATTTCTTATCCAAGAATATGG + Intronic
1050695281 9:8272369-8272391 AGTCTTCTTATCCATGAACATGG + Intergenic
1050788097 9:9430428-9430450 ATTCTTCCTGTCCATGAACATGG - Intronic
1051382200 9:16470436-16470458 AATGTTAATCCCCAAGAACATGG + Intronic
1051969343 9:22868054-22868076 CATTTTCTTATCCAAGTACAGGG - Intergenic
1052890710 9:33696944-33696966 AATGCTCTTGGCCAAGAGAAGGG + Intergenic
1053724308 9:40982391-40982413 ATTCTTCTAGTCCATGAACATGG - Intergenic
1054341661 9:63869609-63869631 ATTCTTCTAGTCCATGAACATGG + Intergenic
1054894430 9:70292287-70292309 AATCTTCTGGTCTATGAACATGG + Intronic
1055116697 9:72612690-72612712 AAACTTCTTGTCCTAGATCATGG - Intronic
1055140081 9:72867143-72867165 AGTGTTCTGATCCATGAACATGG + Intergenic
1055536749 9:77254644-77254666 ACTGTTATAGTCCATGAACATGG + Intronic
1055700657 9:78942219-78942241 AATGTTCTTTTGCTAGAAGATGG - Intergenic
1056159695 9:83876441-83876463 AATTTTCTTATCCACGAGCATGG - Intronic
1057592781 9:96388089-96388111 AATGTTATTGCCCCAGAATATGG - Exonic
1059198071 9:112389642-112389664 AGTGTTCTAATCCATGAACATGG - Intronic
1059214415 9:112547432-112547454 AATGCCCTTGTCCCAGAAAAGGG - Intronic
1059358711 9:113721869-113721891 AATCTTCTAATCCATGAACATGG - Intergenic
1059459685 9:114421800-114421822 GATCTGCTTGTCCCAGAACATGG + Intronic
1059951735 9:119470839-119470861 ATTCTTCTAGTCCATGAACATGG + Intergenic
1060882011 9:127123882-127123904 CATGTTCTTGTCCAAGCAGAGGG - Intronic
1062084323 9:134641165-134641187 GATGTTCCCGTCCAAGCACATGG + Intergenic
1062617008 9:137401861-137401883 AATGTTCATCCCCAAGACCATGG - Intronic
1062740368 9:138170463-138170485 AATGTCCTTATCCAAGAAGAGGG + Intergenic
1185995891 X:4949040-4949062 AATGCCCTTGGCCAAGAGCAGGG - Intergenic
1186710471 X:12190234-12190256 AGTCTTCCTATCCAAGAACATGG - Intronic
1186819063 X:13267775-13267797 ACAGTTCTTGACAAAGAACAGGG + Intergenic
1187805370 X:23114102-23114124 GATGTTCTTGTACAAAAACAAGG - Intergenic
1189864854 X:45316812-45316834 AATCTTCTAATCCATGAACATGG - Intergenic
1189866198 X:45329864-45329886 AGTCTTCTGGTCCATGAACACGG + Intergenic
1190704227 X:53012959-53012981 AATCTTCTGTTCCATGAACATGG - Intergenic
1191590300 X:62875833-62875855 ATTCTTCCTATCCAAGAACATGG + Intergenic
1192003091 X:67177477-67177499 ATTATTCTTATCCATGAACATGG - Intergenic
1192092685 X:68177191-68177213 AATGTTGGTTTCCAAGAACTAGG + Intronic
1192199145 X:69053412-69053434 ATTCTTCCTGTCCATGAACATGG - Intergenic
1192951319 X:76020228-76020250 ATTCTTCTTGTCCATGAGCATGG - Intergenic
1192957228 X:76085108-76085130 AATCTTCTTATCCATGAGCATGG + Intergenic
1193885289 X:86976960-86976982 AGTGTTCTAGTAAAAGAACAAGG + Intergenic
1194493771 X:94583686-94583708 ATTCTTCTTATCCATGAACATGG - Intergenic
1194596037 X:95859507-95859529 AATCTTCCTGCCAAAGAACATGG + Intergenic
1194829010 X:98597313-98597335 AATGTTCATTCCCAAGATCATGG - Intergenic
1195028584 X:100903862-100903884 ATTCTTCTTATCCATGAACATGG - Intergenic
1196238498 X:113311163-113311185 ATTCTTCTTATCCAAGAGCATGG - Intergenic
1196353335 X:114758991-114759013 ATTCTTTTTGTGCAAGAACATGG - Intronic
1196358939 X:114830089-114830111 AATGTTCCAATCCATGAACATGG + Intronic
1196591549 X:117491035-117491057 AATGTCCTTGTCCAAATCCATGG + Intergenic
1196739132 X:119008805-119008827 CATGTTCTTGTCCAAAAAGTAGG - Intronic
1197689246 X:129478981-129479003 AATGACCTTGTTCAAGATCATGG - Intronic
1198190199 X:134296498-134296520 AATCTTCTTATTCAAGAAGAAGG + Intergenic
1199006512 X:142704692-142704714 AATCTTTTTATCCATGAACATGG - Intergenic
1199317709 X:146400348-146400370 AATGTTAATTTCCAAGATCATGG + Intergenic
1199665312 X:150091996-150092018 AATGCTCTTGTTCAATAAAATGG + Intergenic
1199725573 X:150576728-150576750 TATGTTTTTGTGCAAGAAAAGGG - Intronic
1199880396 X:151970070-151970092 GATGTTCCTGTCCATGAGCATGG + Intronic
1200358376 X:155576385-155576407 ACTCTTCTTATCCATGAACATGG - Intronic
1200810136 Y:7475786-7475808 ATTGTTCCTATCCATGAACATGG + Intergenic
1201263881 Y:12187305-12187327 AAAGTACTTGTCCAAGAGGAGGG - Intergenic
1201310553 Y:12595185-12595207 AGTGTTCTTGGCCAACAAAAGGG - Intergenic
1201760049 Y:17527040-17527062 AAGGTCCTTATCCAAGAAGAGGG - Intergenic
1201841505 Y:18378950-18378972 AAGGTCCTTATCCAAGAAGAGGG + Intergenic
1201888683 Y:18917410-18917432 AATGTCCTTATCCAAGAGGAGGG - Intergenic
1202250754 Y:22869780-22869802 AATGTTCTGGTGAAAGTACAAGG + Intergenic
1202403743 Y:24503529-24503551 AATGTTCTGGTGAAAGTACAAGG + Intergenic
1202467036 Y:25166553-25166575 AATGTTCTGGTGAAAGTACAAGG - Intergenic