ID: 1041761203

View in Genome Browser
Species Human (GRCh38)
Location 8:61368488-61368510
Sequence TACTGAGGACAAAACACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 1, 2: 0, 3: 34, 4: 350}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041761203_1041761207 -7 Left 1041761203 8:61368488-61368510 CCCTTTGTGTTTTGTCCTCAGTA 0: 1
1: 1
2: 0
3: 34
4: 350
Right 1041761207 8:61368504-61368526 CTCAGTAGCATTGGTCAGATAGG No data
1041761203_1041761212 4 Left 1041761203 8:61368488-61368510 CCCTTTGTGTTTTGTCCTCAGTA 0: 1
1: 1
2: 0
3: 34
4: 350
Right 1041761212 8:61368515-61368537 TGGTCAGATAGGGGTGGACTGGG No data
1041761203_1041761213 5 Left 1041761203 8:61368488-61368510 CCCTTTGTGTTTTGTCCTCAGTA 0: 1
1: 1
2: 0
3: 34
4: 350
Right 1041761213 8:61368516-61368538 GGTCAGATAGGGGTGGACTGGGG No data
1041761203_1041761211 3 Left 1041761203 8:61368488-61368510 CCCTTTGTGTTTTGTCCTCAGTA 0: 1
1: 1
2: 0
3: 34
4: 350
Right 1041761211 8:61368514-61368536 TTGGTCAGATAGGGGTGGACTGG No data
1041761203_1041761210 -2 Left 1041761203 8:61368488-61368510 CCCTTTGTGTTTTGTCCTCAGTA 0: 1
1: 1
2: 0
3: 34
4: 350
Right 1041761210 8:61368509-61368531 TAGCATTGGTCAGATAGGGGTGG No data
1041761203_1041761208 -6 Left 1041761203 8:61368488-61368510 CCCTTTGTGTTTTGTCCTCAGTA 0: 1
1: 1
2: 0
3: 34
4: 350
Right 1041761208 8:61368505-61368527 TCAGTAGCATTGGTCAGATAGGG No data
1041761203_1041761209 -5 Left 1041761203 8:61368488-61368510 CCCTTTGTGTTTTGTCCTCAGTA 0: 1
1: 1
2: 0
3: 34
4: 350
Right 1041761209 8:61368506-61368528 CAGTAGCATTGGTCAGATAGGGG No data
1041761203_1041761214 11 Left 1041761203 8:61368488-61368510 CCCTTTGTGTTTTGTCCTCAGTA 0: 1
1: 1
2: 0
3: 34
4: 350
Right 1041761214 8:61368522-61368544 ATAGGGGTGGACTGGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041761203 Original CRISPR TACTGAGGACAAAACACAAA GGG (reversed) Intronic
900842045 1:5059596-5059618 TAGTGAAGAAAAAGCACAAAAGG + Intergenic
901456434 1:9365660-9365682 TACTGAAGACCAAACACTACGGG - Intronic
902996783 1:20231781-20231803 TTGTGAAGACAGAACACAAATGG + Intergenic
905195084 1:36269908-36269930 TAAGGAGGAAAATACACAAAAGG + Intronic
905531510 1:38682885-38682907 TACAGAAGAGGAAACACAAATGG - Intergenic
905620568 1:39442388-39442410 TACTCAGGAAAAGACAGAAAGGG - Intronic
906049144 1:42856325-42856347 TAATGGGGACAAAATAGAAAAGG - Intergenic
906928092 1:50140746-50140768 AACTGATGAAAACACACAAATGG - Intronic
907315780 1:53571118-53571140 TACAGAAGAGGAAACACAAATGG + Intronic
908376359 1:63545833-63545855 TAATGAGGAGAAAACACAGGGGG - Intronic
908424726 1:63995495-63995517 AACTGAAGGCAAAAGACAAATGG - Intronic
909362879 1:74785150-74785172 TACAGAGGAATAAGCACAAATGG + Intergenic
909940291 1:81603255-81603277 TACTGAGGTTAAAGAACAAATGG - Intronic
910103567 1:83605161-83605183 TACAGAGGACAATACGAAAACGG + Intergenic
912284633 1:108356037-108356059 TACTGAGAAAAAAAAATAAAGGG - Intergenic
912454740 1:109789864-109789886 TACAGACCCCAAAACACAAATGG - Intergenic
913358835 1:117956115-117956137 TTCACAGGACAAAATACAAATGG - Intronic
913413114 1:118574451-118574473 TACCAAGGACTAAATACAAAAGG + Intergenic
914398835 1:147296838-147296860 TTCTGAGGGCAGAACACATAGGG + Intergenic
914427473 1:147591115-147591137 TACAGATGAGAAAACCCAAATGG - Intronic
914690155 1:150018713-150018735 TATTCAGGAAAAAAGACAAAAGG + Intergenic
915034387 1:152910121-152910143 TAAGCAGGAGAAAACACAAAGGG + Exonic
916223065 1:162463723-162463745 AGCAGAGGACAAAACTCAAAGGG - Intergenic
916569305 1:166010913-166010935 AAATGAGGACAAGACACACAAGG - Intergenic
918241226 1:182622304-182622326 TACTGGGGCCAAAATCCAAAAGG - Intergenic
918762115 1:188423278-188423300 CACTGAGGAGGAAACAGAAATGG - Intergenic
919180290 1:194071529-194071551 CCCAGAGGACAAAACATAAATGG + Intergenic
920587639 1:207183006-207183028 TTCTGAGGACCAACCAGAAATGG - Intergenic
920666538 1:207966749-207966771 TACTCAGGAGCAAAGACAAAAGG - Intergenic
921398467 1:214694085-214694107 TAATGAGGAGGAAGCACAAATGG + Intergenic
921920907 1:220667994-220668016 TTCTGAGGAGAACACACAAATGG + Intergenic
922173749 1:223178754-223178776 GAATGGGGCCAAAACACAAATGG - Intergenic
922618195 1:226975417-226975439 TGCTGAGTATAAAACACACATGG + Intronic
922975283 1:229778947-229778969 TGATGAAAACAAAACACAAAGGG - Intergenic
923119171 1:230974979-230975001 TACTGAAGATAACACACAAATGG + Intronic
1063728731 10:8670631-8670653 TATTGAGAATAAACCACAAATGG + Intergenic
1063935360 10:11072024-11072046 TCCTAAGGACATAACCCAAAAGG - Intronic
1064418524 10:15170113-15170135 AAATGGGGTCAAAACACAAAAGG + Intergenic
1064550050 10:16491503-16491525 TAACGGGGACAAATCACAAAGGG + Intronic
1069236828 10:66086357-66086379 TACTGCAGACTCAACACAAATGG + Intronic
1070016851 10:72542363-72542385 TACAGAGGATTAAAAACAAAAGG + Intronic
1071797906 10:89025720-89025742 GATTGAGGAGAACACACAAAGGG + Intergenic
1073140660 10:101245297-101245319 CAGAGAGGACAGAACACAAAGGG + Intergenic
1073160000 10:101384832-101384854 AACTGAGGACAAGACATAGAAGG + Intronic
1073542318 10:104324129-104324151 GACAGAGGACACAGCACAAATGG + Intronic
1073915561 10:108399169-108399191 CACAGAGGAGGAAACACAAATGG - Intergenic
1075772917 10:124955173-124955195 TATTAAAGACAAAACAAAAATGG + Intronic
1076568988 10:131420019-131420041 TACTTGGGAGAGAACACAAAGGG + Intergenic
1077892964 11:6432526-6432548 GATTGAGGAAAAAAGACAAATGG - Intronic
1078737206 11:14031239-14031261 TAGTGAGCACAGTACACAAAAGG - Intronic
1079499454 11:21086174-21086196 TACTGAGAACAAAACAGATCTGG - Intronic
1080132956 11:28817996-28818018 TCAGGAGGACACAACACAAATGG + Intergenic
1080133005 11:28818374-28818396 TCAGGAGGACACAACACAAATGG + Intergenic
1080667896 11:34351797-34351819 TGCTGAGGAAACATCACAAAGGG + Intronic
1080941881 11:36927568-36927590 TACTAAGTAGTAAACACAAAAGG - Intergenic
1080967837 11:37234305-37234327 AACTGAGGACAAAAGGCAGAAGG + Intergenic
1080999238 11:37647253-37647275 CACTCAGGAAAAAAAACAAAAGG - Intergenic
1082275362 11:50215479-50215501 TACTGAAGACACAAGGCAAAGGG + Intergenic
1083076331 11:60042817-60042839 TATTTAGGACAAAACATAAGGGG - Intronic
1084543124 11:69799583-69799605 TCCTGAGGAGAAAAGAGAAAAGG - Intergenic
1084904931 11:72338317-72338339 CACTGAGCACTAAACAAAAAAGG + Intronic
1086171394 11:83840473-83840495 TATAGATCACAAAACACAAATGG + Intronic
1086763480 11:90664455-90664477 TAATGAGAAGAAAACATAAAAGG + Intergenic
1088209644 11:107440615-107440637 TACTGAGGACAATTGACAAGAGG + Intronic
1089704483 11:120267734-120267756 CACTGAGGACAAAAAAAAAATGG + Intronic
1091235964 11:134022280-134022302 TACGGAGGGCAAAACGAAAACGG - Intergenic
1093027074 12:14254851-14254873 TACAGATGAGAAAACACAGACGG + Intergenic
1094354100 12:29559217-29559239 TTCTGAGGTGAAAACACTAAAGG + Intronic
1095138825 12:38638379-38638401 GACTGAGAAAAAAACACAATGGG + Intergenic
1095841926 12:46702612-46702634 TCCTCAGCACAAAACCCAAAAGG - Intergenic
1096533312 12:52255409-52255431 ACCTGGGGACAAAACACACAAGG + Intronic
1097275839 12:57813164-57813186 TACAGAGGAGGAAACCCAAAAGG - Intronic
1097410285 12:59244036-59244058 TCCTGAATACAGAACACAAATGG - Intergenic
1098099686 12:67001590-67001612 TACTCAAGAGAAAACACAGAGGG - Intergenic
1099351251 12:81571627-81571649 CACTTAGGACAGAACACACAGGG + Intronic
1100222457 12:92520530-92520552 AACAGTGGACAAAACACACAAGG + Intergenic
1100810417 12:98331854-98331876 TACTGAGGATAATACAAAATTGG - Intergenic
1101298873 12:103457072-103457094 AACTGAGGAAAGATCACAAAAGG - Intronic
1102268101 12:111506567-111506589 TGCTGAGGAAAAAATTCAAATGG + Intronic
1103424431 12:120820142-120820164 TACAGATCACAAAACACCAAAGG + Intronic
1103989924 12:124792059-124792081 TACAGAGGACGAAACACGATGGG + Intronic
1104151241 12:126085573-126085595 TACAGAGGACAAACCACAGGAGG - Intergenic
1106525485 13:30537166-30537188 TACTGGGAACTAAACAAAAAAGG - Intronic
1106621929 13:31378594-31378616 AACTGAAGAGAAAACACTAATGG - Intergenic
1107086886 13:36434642-36434664 TACTGAGGATTAAACAGAGAAGG - Intronic
1107320568 13:39182453-39182475 ATCTGAGGAAAAAACACAAAGGG + Intergenic
1108077754 13:46699315-46699337 GCCTGTGGACAAAACACACAGGG - Exonic
1108343046 13:49516415-49516437 TACAGAAGAAAAAATACAAATGG - Intronic
1110260689 13:73481851-73481873 GGCTGAGGACAAAAAACAAGCGG + Intergenic
1110667974 13:78140200-78140222 TATTGAGGACAAGATACAAATGG + Intergenic
1110731817 13:78887291-78887313 TGCTCAGGATAAAACAAAAAAGG + Intergenic
1111281231 13:86028263-86028285 AACTGAAAACAACACACAAATGG + Intergenic
1111872871 13:93856070-93856092 ATCTGAGGAACAAACACAAAAGG - Intronic
1112619250 13:101037792-101037814 TTCTGAGGACAAAAGACAACTGG + Intergenic
1114429566 14:22648721-22648743 TCATGAGGACAACACACCAATGG + Intergenic
1114672929 14:24422100-24422122 TACTGAGGACCAAACTTTAATGG - Intergenic
1114728479 14:24964950-24964972 TAAAGAGGCCTAAACACAAAGGG + Intronic
1115407578 14:33035770-33035792 TAAGGAGGGCAAAACACAAATGG - Intronic
1115476199 14:33815281-33815303 TACCAAGGAGAAAAAACAAAAGG - Intergenic
1115669487 14:35593527-35593549 AACTGAGAAAAAAACACAAAGGG + Intronic
1116465979 14:45233215-45233237 TACTGGAAACAAAACATAAAGGG + Intronic
1117117178 14:52526283-52526305 TACAGGGTTCAAAACACAAAAGG + Intronic
1118600013 14:67465396-67465418 AAATGAGGCCAAACCACAAAAGG + Intronic
1118858474 14:69642857-69642879 TACTCAGCCCAAAACTCAAAGGG + Intronic
1120515336 14:85463802-85463824 TACTGACGGCAAAAGGCAAAGGG - Intergenic
1120678869 14:87454995-87455017 TTCTGAGGATAAAACCCACATGG - Intergenic
1122340727 14:101026822-101026844 TAATGAGGACGAAACACACCTGG + Intergenic
1122340769 14:101027139-101027161 TATTGAGGACGAAACACACCTGG + Intergenic
1123973289 15:25528605-25528627 CTCTGAGCAGAAAACACAAAAGG + Intergenic
1124725297 15:32151233-32151255 TACTGAGGACAGAACCAAATGGG - Intronic
1124936491 15:34177197-34177219 TTCTTAGGACAATACACTAAGGG - Intronic
1125593667 15:40871427-40871449 GACTGAGGACCAGACAGAAAAGG - Intergenic
1125881616 15:43200537-43200559 TACTGAGAAGAAAACATAAAAGG + Intronic
1126152664 15:45537023-45537045 AACTCAGGACTAAACACAACTGG - Intergenic
1126469791 15:48996691-48996713 CAATGAGGACAAAATCCAAATGG + Intronic
1126823976 15:52530742-52530764 TGATGAGGAGAAAACAGAAAGGG + Intergenic
1128385156 15:67142403-67142425 TTTTGAGGACAAATCACCAATGG + Intronic
1129523791 15:76201593-76201615 TACTGAGCAAATAACAGAAAGGG - Intronic
1131152720 15:90057050-90057072 GAGTGAGGCCAGAACACAAAGGG - Intronic
1131391301 15:92051063-92051085 TACTATGGAGAAAACACAACAGG - Intronic
1133528715 16:6632399-6632421 CACTGATGACAACACACAACTGG - Intronic
1133730061 16:8571067-8571089 CACAGAGGAAAAAAAACAAAAGG - Intronic
1135187096 16:20324355-20324377 CAATGAGGACAATACACACACGG + Intronic
1135378879 16:21976073-21976095 TACTGAGGCAAAAACACAGATGG - Intronic
1138122235 16:54409972-54409994 TATTGAGTACAAATGACAAATGG + Intergenic
1139070605 16:63377030-63377052 TAGTGAGGAGATAACAGAAAAGG + Intergenic
1139353187 16:66350773-66350795 TACTGAGGACAGAACTCACCTGG + Intergenic
1140279973 16:73545064-73545086 TTCAGAGCACGAAACACAAAGGG + Intergenic
1141127317 16:81409828-81409850 TACTAAGGAGAAAACTTAAATGG - Intergenic
1141271761 16:82547389-82547411 TAGTGAGGACCAAAGACACAAGG - Intergenic
1141740525 16:85889020-85889042 TGCTGGGGACAGGACACAAATGG - Intergenic
1142176369 16:88647237-88647259 TACTGAAGACAACACAGAGAGGG + Intronic
1143062351 17:4212559-4212581 TACTAAGGAAAAATCACAAAAGG + Intronic
1146830019 17:36060577-36060599 GACTGAGGAGAATACACAGATGG - Intergenic
1147436016 17:40416042-40416064 TGCTGCGGACAACAAACAAAGGG - Exonic
1148827276 17:50403163-50403185 GATTGAGGAAAAAACACAATGGG - Intergenic
1148902242 17:50887161-50887183 TAATGAAAACAACACACAAAGGG + Intergenic
1149554856 17:57566096-57566118 AAATGAGGAGAAAACCCAAAAGG - Intronic
1150450818 17:65266203-65266225 TACTAATGACAAAAGGCAAATGG - Intergenic
1151885729 17:76922363-76922385 AACTGAGAACCACACACAAAAGG - Intronic
1152215009 17:79027043-79027065 CCCTGAGGACAAGACACAAATGG - Intronic
1155018237 18:21868273-21868295 CACTGAGGAGAAAACAAAAAGGG - Exonic
1155111808 18:22723059-22723081 TACAGAGGAAAAAACAAACAAGG + Intergenic
1155725744 18:29080637-29080659 TACTGAGGACAAAAGCAACAAGG - Intergenic
1155899479 18:31370691-31370713 TACTGAACACAAAAATCAAAAGG + Intergenic
1156650078 18:39215302-39215324 TACAGGGGACAAAAGTCAAAGGG + Intergenic
1157751814 18:50185664-50185686 TACTGTCAACAAAAAACAAAAGG + Intronic
1157865369 18:51178950-51178972 TATTGAGGACAAAAAAGGAAGGG - Intronic
1158939923 18:62398158-62398180 TACTGAGTAGAAAACAAAATCGG - Intergenic
1159547125 18:69853405-69853427 TTCTGAGAAAAAAACACAATAGG - Exonic
1159815731 18:73072000-73072022 TTCTGAGGAAACAAGACAAAAGG - Intergenic
1160478981 18:79220922-79220944 TACTGAGGCAAAAGCACAAGAGG - Intronic
1162887676 19:13708151-13708173 AACTGAGGACACAACCCAACAGG - Intergenic
1163608671 19:18290039-18290061 TACTGAAGTAAAAACAGAAAAGG - Intergenic
1163935667 19:20440954-20440976 TTCTGAGTCCAAAACCCAAAAGG + Intergenic
1164019438 19:21285864-21285886 TAGTGAAGACACAACAAAAAAGG - Intronic
1166938399 19:46348728-46348750 GACTTAGGACAGAACCCAAATGG + Intronic
1168013569 19:53554105-53554127 TACTCAGGCCCAAACACACAGGG - Intronic
1168444126 19:56397055-56397077 AACTGAGGACAAAATACATGTGG + Intergenic
1168576684 19:57517461-57517483 TACTGAGGACAACACAGCAGAGG - Intronic
925574295 2:5344556-5344578 AACTGAGGAAGAAACACAATAGG + Intergenic
925859644 2:8162188-8162210 TACAAAGGATAAAACACAACTGG - Intergenic
926053318 2:9758293-9758315 TTCTGGGGACACAACAGAAAAGG - Intergenic
927731022 2:25471786-25471808 TACTCAGGAGAAAACATAAATGG - Intronic
928290690 2:30034618-30034640 GACTCAGGACATAAAACAAAAGG - Intergenic
928519147 2:32071196-32071218 TACATAGGACTAAACAGAAAAGG + Intronic
928853404 2:35776158-35776180 TATTGAAGACACAACAAAAATGG - Intergenic
930012894 2:46951157-46951179 TACTGAGTACAAGACACTGAGGG + Intronic
930447583 2:51494225-51494247 TACAGAAGAGGAAACACAAATGG + Intergenic
932800231 2:74735285-74735307 TAGTCAGAAAAAAACACAAATGG - Intergenic
933142743 2:78814372-78814394 TACTTACCAGAAAACACAAAGGG - Intergenic
933680183 2:85092985-85093007 TACTGAAGAAAAAACAAAATTGG - Intergenic
934615695 2:95769345-95769367 TACTGGGGACAAAAGAGAACTGG - Intergenic
936880221 2:117241544-117241566 TACTGAAGTTAAAACAGAAAGGG - Intergenic
937336569 2:121065926-121065948 TACTGAGGACCCAGCAGAAAGGG + Intergenic
939064986 2:137471836-137471858 TGCTGAGGGCAAAAGCCAAAAGG + Intronic
939765435 2:146243130-146243152 TTCTGAGTATAAAAAACAAAAGG + Intergenic
939973157 2:148685017-148685039 TACAGAAGAGAAAACCCAAAAGG - Intronic
940747098 2:157579944-157579966 TACAGAGGAGAAAATCCAAATGG - Intronic
941346786 2:164379318-164379340 CACTGAGGAATAAACATAAAAGG - Intergenic
941467744 2:165849918-165849940 TAGAGAGGACACAAAACAAATGG - Intergenic
942526071 2:176854254-176854276 TAGTCAGGAAAAACCACAAAAGG - Intergenic
942783264 2:179671451-179671473 TATTCAAGACAAAACACGAAGGG + Intronic
943352711 2:186814081-186814103 TTCTGAGTACAACACACCAACGG - Intergenic
943581786 2:189692892-189692914 GAATGAGGAAAAAATACAAAAGG - Intronic
944998231 2:205318972-205318994 TACTGAGGAGAACACAAAAATGG - Intronic
946820656 2:223625990-223626012 TAGTGAGGCCAGAAGACAAAGGG + Intergenic
947055803 2:226101851-226101873 TACCGAGCACAACATACAAATGG - Intergenic
1168843227 20:923124-923146 TAATGAAAACAAAACACAGAGGG - Intergenic
1170696877 20:18667250-18667272 TGCTGAGAACAAAACACTCAAGG - Intronic
1170894764 20:20403138-20403160 TACTGAGGAGAAAAGACAACAGG - Intronic
1170954169 20:20963435-20963457 TAAAGAGGACAAACTACAAATGG - Intergenic
1171402911 20:24890875-24890897 CACTGAAGACAAACCCCAAATGG + Intergenic
1175583361 20:60117764-60117786 TTCTGTGGAGAAAACAAAAAAGG + Intergenic
1177011539 21:15736052-15736074 TACTGACGACAAAACAAGCAGGG - Intronic
1177097154 21:16850044-16850066 TAATGGAGACAAAAAACAAATGG - Intergenic
1177685642 21:24434338-24434360 ATCTGAGGACAGAAAACAAAGGG - Intergenic
1177705730 21:24701945-24701967 TATTTAGGACAAAACACCCAGGG + Intergenic
1178908882 21:36658500-36658522 TTCTGAGGACAAATCACACATGG - Intergenic
1179635244 21:42704506-42704528 TCCTAAGGACAAACCCCAAATGG - Intronic
1181140625 22:20802366-20802388 TACTGATGACCAACCACCAAAGG + Intronic
1181455979 22:23060530-23060552 TACTCTGCACAAAACACACATGG + Intronic
1182508050 22:30799519-30799541 AACTGAGGCCCAAAGACAAAGGG + Intronic
1184913309 22:47550325-47550347 CACAGAGGAGAAAAGACAAACGG - Intergenic
949103522 3:175497-175519 TACTGAGAACACCACAGAAAGGG + Intergenic
949257595 3:2067277-2067299 TATTTAGAACAAAACATAAATGG + Intergenic
949651963 3:6170217-6170239 AACAGAAAACAAAACACAAAAGG + Intergenic
949911430 3:8912339-8912361 TACAAAGGACCAAACAGAAAAGG - Exonic
950583604 3:13878640-13878662 TAGTAGTGACAAAACACAAAGGG + Intronic
950832342 3:15887288-15887310 TATTCAGGAGAAAACACCAAGGG + Intergenic
952142854 3:30499019-30499041 TCCTGAGTACAAAGCACACACGG - Intergenic
952188369 3:30995340-30995362 TACTGAGTACAATACCCAATAGG - Intergenic
952584182 3:34871447-34871469 TACTGAGGACATAAAAATAAGGG + Intergenic
955381545 3:58442373-58442395 TACAGAGTAAAAAACACAAAAGG + Intergenic
956096060 3:65717621-65717643 CACTGAGGACAACATAAAAACGG + Intronic
956096158 3:65718710-65718732 CACTGAGGACAACATAAAAACGG + Intronic
956943513 3:74193224-74193246 TACCTAGGGAAAAACACAAAAGG + Intergenic
957197841 3:77093355-77093377 GACTGAGAACAAAACAGTAAGGG - Intronic
957620815 3:82591484-82591506 TAATGAAGACAAAACCCCAAAGG + Intergenic
958562944 3:95771442-95771464 TAATAAGTAAAAAACACAAAAGG - Intergenic
958883799 3:99703302-99703324 TACAGATGACAAAACTGAAACGG + Intronic
959281869 3:104352581-104352603 AACTGGGGAAAAAACATAAATGG - Intergenic
959656555 3:108812365-108812387 TACTCAGGAAAAAAAAAAAAAGG - Intergenic
960879955 3:122334131-122334153 TAGTGAGGACAAACCAGAAGTGG - Intronic
961824067 3:129589661-129589683 AGCTGAGGCCCAAACACAAACGG + Intronic
963535596 3:146523859-146523881 TACTGAGGACTATGTACAAATGG - Intronic
964999215 3:162930876-162930898 GACTAAGCACAAAACCCAAATGG + Intergenic
965002736 3:162977304-162977326 AACTGAAGATAAAACTCAAATGG - Intergenic
965117481 3:164510873-164510895 CACAGAGGAAAAAACCCAAATGG + Intergenic
965921200 3:173916294-173916316 TACAGAGCCCAAAACACAATTGG + Intronic
966718357 3:183036425-183036447 TACAGAGGACAAAACAAAGTAGG + Intronic
967305660 3:188056634-188056656 TCCTGAGGGCAAAACCAAAAAGG + Intergenic
967637041 3:191814631-191814653 TACAGACAACAAAACAAAAATGG + Intergenic
967680481 3:192356589-192356611 AATTGAGTACAAAACACAAATGG - Intronic
969404719 4:6982989-6983011 TACACAGAACAAAATACAAAAGG - Intronic
970096784 4:12472436-12472458 TGTTCAGGACAGAACACAAAGGG - Intergenic
972945161 4:44244808-44244830 TACTGATGATTGAACACAAAGGG - Intronic
973114059 4:46432743-46432765 GACTGAGGAGATAACACAACAGG + Intronic
973224342 4:47765797-47765819 AACTGAAGACAAAATGCAAATGG - Intronic
973925799 4:55736066-55736088 TAATGAGGACAAATGACAATGGG - Intergenic
974440634 4:61911831-61911853 TACTGAGGAAAAAAAAAAATTGG + Intronic
975942392 4:79662459-79662481 TAATGAGCACAGAACCCAAAAGG - Intergenic
975995116 4:80304352-80304374 TATAGAGCACTAAACACAAATGG - Intronic
976679730 4:87743348-87743370 GAATGAGGCCAAACCACAAAGGG + Intergenic
977125120 4:93155731-93155753 GACAGAGCATAAAACACAAAGGG + Intronic
977314641 4:95430494-95430516 TACACACCACAAAACACAAATGG + Intronic
977740418 4:100474222-100474244 TTCCAAGGACAATACACAAATGG + Intronic
977783584 4:101007020-101007042 CACTGAGTACAGTACACAAATGG - Intergenic
978261740 4:106768324-106768346 TACAGAGGATAGAACACCAATGG + Intergenic
978299036 4:107244043-107244065 TAATTATGACAAAAGACAAAAGG - Intronic
978667751 4:111206353-111206375 TATTGAGAACAAATAACAAAGGG - Intergenic
980317043 4:131215494-131215516 TACTGAGGCCAAATCAAAGAAGG + Intergenic
980981475 4:139658058-139658080 TTTTGATGAGAAAACACAAAAGG - Intergenic
982402096 4:154979214-154979236 TTCTGAAGACAAAAAAGAAATGG - Intergenic
982801928 4:159716425-159716447 TACTTAGAACAAGCCACAAAAGG - Intergenic
983491680 4:168397437-168397459 GAATGAGAACAAAAGACAAAGGG + Intronic
983907897 4:173204507-173204529 TACAGAGGAGAAAAAAGAAAAGG - Intronic
983915876 4:173289968-173289990 TACTGAGAACAAAATATAAGAGG + Intronic
985972110 5:3386575-3386597 TGCTGAAGACACAACACAGAAGG - Intergenic
986317808 5:6602333-6602355 TTCTGAGGAACAATCACAAAAGG + Intronic
988460534 5:31432667-31432689 TTCTGAGGCCAAATCAGAAAAGG - Intronic
989844310 5:46121325-46121347 TACTCAGGATAAAAAACATAAGG - Intergenic
990129727 5:52566143-52566165 GACTGAGGGCAAAGCAAAAAGGG + Intergenic
990682859 5:58265168-58265190 TACTGTGAACAAAACATTAAGGG + Intergenic
991352110 5:65730003-65730025 TACTGAGGAGGAAACAGATACGG - Intronic
992475217 5:77095364-77095386 TCCTGAGGACAAAGCACAATCGG - Intergenic
993033254 5:82728815-82728837 TTCTGAGGGGAAAACAGAAATGG - Intergenic
993847547 5:92963401-92963423 TACTGAGGAAAAACTAGAAATGG + Intergenic
994464554 5:100110235-100110257 TACTAAGAACAAAAAAGAAATGG - Intergenic
994947134 5:106409769-106409791 TTCTGAGAACAAAAGACAAAAGG - Intergenic
995304811 5:110632185-110632207 TACTCAGAACCAAATACAAAGGG + Intronic
995337814 5:111022335-111022357 AACTGAGGACAAAACTCACGAGG - Intergenic
995364781 5:111346248-111346270 TCCTGAGGAAAAAAAACAAAAGG + Intronic
996175815 5:120355489-120355511 TACTGAGAAAAATAAACAAAAGG + Intergenic
996223981 5:120967246-120967268 TATTAAGGACAAAAAAAAAATGG + Intergenic
997002384 5:129776982-129777004 TACTGAGCACAAAAAAAAATAGG + Intergenic
998464747 5:142334503-142334525 TGCTGAGGACAGATCACAAAAGG + Intergenic
998904132 5:146885962-146885984 GACTGAGGATAAAAAAAAAAGGG + Intronic
999176696 5:149636826-149636848 TACAGATGAGAAAACAGAAAAGG - Intergenic
999503412 5:152169626-152169648 TATTGAAGATAAAACAGAAAAGG - Intergenic
999524402 5:152387797-152387819 AAATGAGGAGAAAACAAAAAAGG + Intergenic
1000241559 5:159413240-159413262 TACGGAGAAAAAAATACAAATGG + Intergenic
1000784196 5:165523844-165523866 TTCTGAAGCCAAAACTCAAAGGG - Intergenic
1001684142 5:173580537-173580559 TACAGAAGAAAAAACACAAATGG + Intergenic
1001726137 5:173902417-173902439 GACTGAGTCTAAAACACAAAAGG - Intronic
1002609555 5:180406166-180406188 TGCTCAGTAAAAAACACAAACGG + Intergenic
1004236623 6:13880269-13880291 CACTGAGGAAAAAACACAATGGG + Intergenic
1004966992 6:20863241-20863263 AACTGAGACCAAAATACAAAGGG - Intronic
1007534740 6:42576476-42576498 TACTGAACACAAAATCCAAATGG - Intronic
1008101356 6:47394565-47394587 TACTGAGAATAATACAAAAAAGG - Intergenic
1010072219 6:71756813-71756835 TGGTGAGGACAGGACACAAAAGG + Intergenic
1010492225 6:76490008-76490030 TACTGACGACAAAAACCATAGGG - Intergenic
1010810195 6:80291651-80291673 TACTCAGAAAAAAAAACAAAAGG - Intronic
1011281437 6:85681695-85681717 TACTGCATACAAAAAACAAATGG - Intergenic
1013229958 6:108153282-108153304 TACAAAAGAGAAAACACAAATGG + Intronic
1013555908 6:111257404-111257426 GACTCATGACAAAATACAAATGG + Intergenic
1014725437 6:124966066-124966088 TACTTAAGACAAAAGACAAAGGG + Intronic
1015506888 6:133997830-133997852 TACTGAGGACAAAAAGGAAAAGG - Intronic
1015707685 6:136106055-136106077 TACTGAGAAGAAAATACTAATGG + Intronic
1016208401 6:141498936-141498958 TACTGAGGAAAATATTCAAATGG + Intergenic
1016436094 6:144039209-144039231 TACTGAAGAATAAACAGAAATGG + Intronic
1016598593 6:145829448-145829470 TACTGAGGACAAGATACATTTGG + Intergenic
1017393233 6:153964717-153964739 TAATCAGGATAAAGCACAAATGG - Intergenic
1017517666 6:155171861-155171883 AGATGAGGAGAAAACACAAAAGG - Intronic
1018663379 6:166110257-166110279 GCCTCTGGACAAAACACAAAAGG + Intergenic
1019966084 7:4499836-4499858 TCCTTAGGACATAGCACAAAGGG + Intergenic
1020415217 7:7937831-7937853 CACTGAAGAGAAAACACAAATGG + Intronic
1020432178 7:8125678-8125700 AGCTGAGGACAAAACAGACAAGG - Intronic
1020903036 7:14029310-14029332 AAGTGAGGACAAAAACCAAAAGG - Intergenic
1021257758 7:18414911-18414933 GAATGAGGACCAAATACAAAGGG - Intronic
1021796875 7:24264404-24264426 TACTGAGAATAAAACATTAAAGG - Intergenic
1022936438 7:35183813-35183835 TACTGAAAAAAAAACAAAAAAGG - Intergenic
1024349084 7:48344734-48344756 TACAGAGGACAGGACACGAATGG - Intronic
1026456619 7:70578136-70578158 TACTGAGGACAAAACACATATGG - Intronic
1026684387 7:72495638-72495660 AACAGAGAACAAAACTCAAATGG + Intergenic
1028006362 7:85574379-85574401 TACTCAGAAGAAAACAAAAAAGG - Intergenic
1028163085 7:87508019-87508041 TACTGAGCACAGAACCCAATAGG - Intronic
1028366549 7:90038964-90038986 TACTTAGGACAAGAGACAAATGG + Intergenic
1029128886 7:98314826-98314848 TGCTGAGGACACATCAGAAAGGG + Intronic
1031476519 7:122229480-122229502 TGCTGATGACAAATCACAATTGG - Intergenic
1031936033 7:127736729-127736751 TTCTGGCAACAAAACACAAAGGG - Intronic
1032005378 7:128298194-128298216 TTCTGAGGAAACAAGACAAAAGG - Exonic
1032176668 7:129635018-129635040 TTCTGAGGACAAAGCAGAACTGG - Intronic
1034485965 7:151362755-151362777 TACTGAGCAGAAGACTCAAAAGG - Intronic
1036096178 8:5726696-5726718 CTCTGAGGACAAAACTCGAAGGG - Intergenic
1036650816 8:10642512-10642534 TACTAAACACAAAAGACAAAAGG + Intronic
1037696354 8:21227536-21227558 GACTTAGGACAAAACACAGAGGG - Intergenic
1037795577 8:21991008-21991030 TACTGTTGAAAAAACAGAAAAGG - Intronic
1038022241 8:23560487-23560509 TACAGAGGAGAAAAAACAATGGG - Intronic
1038503843 8:28067556-28067578 TACTGAGGGCGAAGCCCAAAAGG - Exonic
1038946593 8:32368112-32368134 TACTGAGCAAAAAACAAAACTGG - Intronic
1041516589 8:58706265-58706287 TACTTAGCAAAAAACACAAAGGG - Intergenic
1041696037 8:60737338-60737360 TAGTGAGGACAAAATATTAAAGG - Intronic
1041761203 8:61368488-61368510 TACTGAGGACAAAACACAAAGGG - Intronic
1043087636 8:75855085-75855107 TTCTGAGGACAGAACCCTAATGG + Intergenic
1043132133 8:76474490-76474512 CACTGAGGACTAAGAACAAAAGG - Intergenic
1043867872 8:85396156-85396178 TACTGAAGCAAAAACACAACTGG + Intronic
1043960934 8:86417629-86417651 AACTCAGGATAAAACAGAAAAGG + Intronic
1044891367 8:96839675-96839697 TCTTGAGGACAAAAAACACATGG - Intronic
1045705879 8:104921761-104921783 GATTCAGGACAAAACATAAAGGG - Intronic
1046278160 8:111989442-111989464 AACTGACGACAAAAAACACATGG + Intergenic
1046691155 8:117286124-117286146 AACTGAGGAGAAAGCAAAAATGG + Intergenic
1047778564 8:128093198-128093220 TACTGATGAGAAAACAGAAGTGG - Intergenic
1047872358 8:129098132-129098154 TGCTCAGGAGAAAACACAAAGGG + Intergenic
1048166590 8:132067093-132067115 TACTGTGGCCAAAGCACAGAGGG + Intronic
1048427131 8:134333128-134333150 TACCAAGGACAAAAGGCAAACGG + Intergenic
1048803930 8:138221667-138221689 TATTGAGGAGAAAACTCAGAAGG + Intronic
1050187469 9:2989923-2989945 TACTGAAGAGAAAGCACAAATGG + Intergenic
1052167427 9:25350061-25350083 TTATGAGGACAAAAAAAAAATGG + Intergenic
1053280125 9:36815048-36815070 TAATGAGGTCAATATACAAATGG - Intergenic
1056045778 9:82714102-82714124 CAGTGAGAAAAAAACACAAATGG + Intergenic
1056490538 9:87102592-87102614 TACTGAGGGTAAAGCTCAAATGG + Intergenic
1056624023 9:88238973-88238995 TGCTTAAAACAAAACACAAAGGG - Intergenic
1058186577 9:101862351-101862373 TATTGAGGGCAAAGGACAAAGGG + Intergenic
1059770385 9:117418123-117418145 AACTGAAGACAAGACAGAAAAGG + Intergenic
1060315559 9:122507070-122507092 TACTCAGGACAACACAAATATGG + Intergenic
1060594981 9:124842208-124842230 TAATCAGAATAAAACACAAAGGG - Intergenic
1060760920 9:126247965-126247987 CACAGAGGTCAAAATACAAATGG - Intergenic
1062383232 9:136297799-136297821 TTCTGAGGGAAAAACCCAAAAGG - Exonic
1186323826 X:8457726-8457748 TATTGAAGACAAAACCCAAATGG - Intergenic
1186388604 X:9135249-9135271 TACTGAAGAACAAACAAAAATGG - Intronic
1186483727 X:9916721-9916743 TACAAAAGAAAAAACACAAATGG - Intronic
1186518972 X:10188749-10188771 TAAGAAGGACAGAACACAAATGG + Intronic
1187627492 X:21132068-21132090 AACAGAGTACAAAACACATAAGG - Intergenic
1188154856 X:26728901-26728923 TACTGAGAACAAAATAGAGAAGG - Intergenic
1188266163 X:28077968-28077990 TACTTAGGAGAAAATATAAATGG - Intergenic
1189516682 X:41719464-41719486 GACTAATGACAAAACAGAAATGG - Intronic
1190025442 X:46917937-46917959 TAGTGAGGCCTAAACAAAAATGG + Intronic
1190855390 X:54289342-54289364 TGCTGGGGACATATCACAAAGGG + Intronic
1191202038 X:57793656-57793678 TAATCAGAAGAAAACACAAAGGG - Intergenic
1191884555 X:65875120-65875142 GACTGAGGGCATAACACAGAAGG + Intergenic
1192056593 X:67779996-67780018 TAGAGAGGCCAAAACACAATGGG + Intergenic
1193521348 X:82533202-82533224 CAGTGAGGACAAAACAACAAAGG + Intergenic
1194534499 X:95088669-95088691 GACTGAAAACAAAAGACAAAGGG + Intergenic
1195128803 X:101835219-101835241 TTCTGAGGGAAAAAGACAAAGGG + Intronic
1196164172 X:112520166-112520188 TACTGAAGTTAAAACACAGAGGG + Intergenic
1196398564 X:115290748-115290770 GAAGGAGGACAAAACAGAAAAGG + Intronic
1196414299 X:115454587-115454609 AACTGAGCACTTAACACAAAAGG + Intergenic
1196706967 X:118725339-118725361 TCGTGAGGAAAAAAAACAAACGG - Intergenic
1197314000 X:124941471-124941493 TACAGAGTAGAAAACATAAAAGG - Intronic
1197758715 X:130013593-130013615 GACTGAGGCCGAAACAGAAAGGG - Exonic
1198710890 X:139502338-139502360 TACTGAGGAGAAAGTACAGATGG - Intergenic
1198869737 X:141163963-141163985 TAAAGAGGATGAAACACAAATGG + Intergenic
1199244812 X:145590883-145590905 TAATGTGTACAAATCACAAATGG - Intergenic
1200879671 Y:8199691-8199713 CACTCAAGACAAAACACCAAAGG + Intergenic
1201166325 Y:11212517-11212539 TTCTGATGCCAAAACAAAAAAGG - Intergenic