ID: 1041761204

View in Genome Browser
Species Human (GRCh38)
Location 8:61368489-61368511
Sequence CTACTGAGGACAAAACACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 243}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041761204_1041761214 10 Left 1041761204 8:61368489-61368511 CCTTTGTGTTTTGTCCTCAGTAG 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1041761214 8:61368522-61368544 ATAGGGGTGGACTGGGGCAGAGG No data
1041761204_1041761212 3 Left 1041761204 8:61368489-61368511 CCTTTGTGTTTTGTCCTCAGTAG 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1041761212 8:61368515-61368537 TGGTCAGATAGGGGTGGACTGGG No data
1041761204_1041761211 2 Left 1041761204 8:61368489-61368511 CCTTTGTGTTTTGTCCTCAGTAG 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1041761211 8:61368514-61368536 TTGGTCAGATAGGGGTGGACTGG No data
1041761204_1041761208 -7 Left 1041761204 8:61368489-61368511 CCTTTGTGTTTTGTCCTCAGTAG 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1041761208 8:61368505-61368527 TCAGTAGCATTGGTCAGATAGGG No data
1041761204_1041761213 4 Left 1041761204 8:61368489-61368511 CCTTTGTGTTTTGTCCTCAGTAG 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1041761213 8:61368516-61368538 GGTCAGATAGGGGTGGACTGGGG No data
1041761204_1041761207 -8 Left 1041761204 8:61368489-61368511 CCTTTGTGTTTTGTCCTCAGTAG 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1041761207 8:61368504-61368526 CTCAGTAGCATTGGTCAGATAGG No data
1041761204_1041761209 -6 Left 1041761204 8:61368489-61368511 CCTTTGTGTTTTGTCCTCAGTAG 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1041761209 8:61368506-61368528 CAGTAGCATTGGTCAGATAGGGG No data
1041761204_1041761210 -3 Left 1041761204 8:61368489-61368511 CCTTTGTGTTTTGTCCTCAGTAG 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1041761210 8:61368509-61368531 TAGCATTGGTCAGATAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041761204 Original CRISPR CTACTGAGGACAAAACACAA AGG (reversed) Intronic
901410754 1:9082170-9082192 CTACTGAGGAAAAAACAGTTTGG + Intronic
901456435 1:9365661-9365683 TTACTGAAGACCAAACACTACGG - Intronic
902273302 1:15321962-15321984 CAAATGAAGCCAAAACACAATGG - Intronic
905015967 1:34778726-34778748 CTAATGACAACAAAACCCAAGGG + Intronic
905620569 1:39442389-39442411 CTACTCAGGAAAAGACAGAAAGG - Intronic
906231011 1:44164367-44164389 CTTCTGAGGACAAACTAGAATGG + Intergenic
906599288 1:47110270-47110292 CTAAATAGAACAAAACACAATGG + Intronic
906811801 1:48834588-48834610 CTACTGAGGACACAGCAAGAAGG + Intronic
906840383 1:49132118-49132140 CTACTGAGGAAAAAATAAACAGG + Intronic
907260067 1:53211343-53211365 GCACTGAGGACAAGACCCAAGGG - Intronic
907994285 1:59613395-59613417 CTACTGGGTACATAACAAAATGG + Intronic
908118454 1:60963710-60963732 CTCCTGAGAACATGACACAAAGG - Intronic
908376360 1:63545834-63545856 GTAATGAGGAGAAAACACAGGGG - Intronic
908896544 1:68907343-68907365 CTAGTGAGAACAAAAATCAAAGG + Intergenic
912307448 1:108583803-108583825 GTATGCAGGACAAAACACAAGGG + Intronic
912742109 1:112208311-112208333 CTACAGAAGACAAATCACTATGG + Intergenic
912968904 1:114261920-114261942 CTGCTGAGGGCAGAGCACAAAGG - Intergenic
914418506 1:147506744-147506766 GTACTGAGGTCAAAATAAAAAGG - Intergenic
917436813 1:175030501-175030523 CTGGTAAGAACAAAACACAAAGG - Intergenic
917575283 1:176314741-176314763 CTACTCATGACAAAAGGCAAAGG - Intergenic
918070375 1:181129807-181129829 CTGCTGAGGACAATACAGACTGG + Intergenic
918947801 1:191092490-191092512 GTACTGAGGACAGTACCCAATGG + Intergenic
919290971 1:195629834-195629856 CAAGTAAGCACAAAACACAAAGG + Intergenic
919416821 1:197321038-197321060 TTGCTGAGCACAAAACACCAGGG - Intronic
923283843 1:232471506-232471528 CTACTGAGGAAAAGGCACATAGG - Exonic
923526220 1:234774959-234774981 ATACCAAGGACAAGACACAAAGG + Intergenic
1065519798 10:26560710-26560732 ATACTGGGGAGAGAACACAAAGG - Exonic
1066090138 10:32009710-32009732 CAACTGAAAACAAAACATAAAGG + Exonic
1067332416 10:45334324-45334346 GTCCTGAGGACAACAGACAATGG - Intergenic
1068286249 10:54939788-54939810 CATCTGAGGACACAACAAAAAGG - Intronic
1069285233 10:66706152-66706174 CTACTGCCTACAAAAAACAATGG + Intronic
1069327237 10:67246059-67246081 CTTCTGAACCCAAAACACAATGG + Intronic
1070507280 10:77125213-77125235 CTTCTGAGCAGAGAACACAAGGG - Intronic
1074913568 10:117934776-117934798 TTACTGATCACAAAACAAAAAGG - Intergenic
1075938560 10:126366479-126366501 CTACTCAGTACAAAAGAAAATGG + Intronic
1076084227 10:127610985-127611007 CTACTGAGAACAGAACACTCTGG + Intergenic
1076302565 10:129439114-129439136 TTACTGAGAACAAACCACAGAGG + Intergenic
1078493568 11:11793195-11793217 AGACTGAGGACAAAGCAAAATGG - Intergenic
1079768274 11:24422758-24422780 CTACTGAAAACAAAAAAGAAAGG + Intergenic
1079892400 11:26072993-26073015 CATCTGAGTACAAAAGACAAAGG + Intergenic
1080243138 11:30150430-30150452 CCACTGGGGAAAAGACACAAAGG - Intergenic
1081167361 11:39822454-39822476 CAAGTGATGACAAAACACCAAGG - Intergenic
1082275361 11:50215478-50215500 CTACTGAAGACACAAGGCAAAGG + Intergenic
1082893247 11:58162860-58162882 CTTCTGAGGACAAAATGGAAGGG + Intronic
1083076332 11:60042818-60042840 ATATTTAGGACAAAACATAAGGG - Intronic
1085556296 11:77425486-77425508 CTTCTGAGGAGAAATCTCAAAGG - Intronic
1087896743 11:103594653-103594675 CTACTGAGGACAGGGGACAAGGG + Intergenic
1089004646 11:115081249-115081271 GCACTGGGGACAAAACACCAGGG + Intergenic
1090228190 11:125084054-125084076 CTACTGGAGACCAAACAAAAGGG - Intronic
1091417755 12:304328-304350 CAACAGAGGACATCACACAAAGG + Intronic
1091477797 12:794139-794161 CAACTGATGAATAAACACAATGG - Intronic
1093023933 12:14229673-14229695 CTACTGAGGACAACACCAAGGGG - Intergenic
1093189154 12:16055369-16055391 CTAGTGAGGACAGGAGACAAGGG + Intergenic
1093386698 12:18565465-18565487 CTTCTGAGGACAAGACAAAAGGG + Intronic
1093854321 12:24081556-24081578 CTACGGAGGAAAAAAAATAAAGG - Intergenic
1094393195 12:29975790-29975812 CTACTGAGTACATAACGAAATGG + Intergenic
1094779641 12:33775749-33775771 CTACTGGGTACATAACAAAATGG + Intergenic
1094873275 12:34611750-34611772 CTACTGGGTACATAACGCAATGG - Intergenic
1095138824 12:38638378-38638400 TGACTGAGAAAAAAACACAATGG + Intergenic
1096889894 12:54759035-54759057 CTTCTCAGGAGAAAACATAAAGG - Intergenic
1098099687 12:67001591-67001613 CTACTCAAGAGAAAACACAGAGG - Intergenic
1099351250 12:81571626-81571648 CCACTTAGGACAGAACACACAGG + Intronic
1100096048 12:91038369-91038391 CAACTGAGGATGAAACACAGTGG - Intergenic
1101311489 12:103584581-103584603 CCACTGAGGACAGATCACAGGGG + Intergenic
1102046242 12:109832117-109832139 TTACAGAGGAGAGAACACAAAGG + Intronic
1103989923 12:124792058-124792080 CTACAGAGGACGAAACACGATGG + Intronic
1104700067 12:130896395-130896417 ATTCTGAGGACAGAAGACAAAGG - Intergenic
1105576056 13:21653199-21653221 CTTCAGAGGACAATACATAAGGG + Intergenic
1105706975 13:22973588-22973610 CTGCTGAAGACAAAATTCAAGGG + Intergenic
1107320567 13:39182452-39182474 AATCTGAGGAAAAAACACAAAGG + Intergenic
1107601598 13:42019583-42019605 AAACTGAGGAGACAACACAAAGG - Intergenic
1109899669 13:68749922-68749944 TTATTGAGGAAAAGACACAAAGG - Intergenic
1109928038 13:69172621-69172643 TTAATAAAGACAAAACACAAAGG + Intergenic
1111046143 13:82815085-82815107 CTACTGTGAATAAGACACAAAGG + Intergenic
1111224049 13:85245884-85245906 TTACTGAGGACAGAACAACATGG + Intergenic
1111495366 13:89042032-89042054 GTATTCAGAACAAAACACAAAGG + Intergenic
1111699198 13:91664416-91664438 GTGTGGAGGACAAAACACAAGGG - Intronic
1113256160 13:108508489-108508511 CCACTGAGAACAAAAGAGAACGG - Intergenic
1114901486 14:27065352-27065374 CTATGTAGGACAAAACACATAGG - Intergenic
1115669486 14:35593526-35593548 AAACTGAGAAAAAAACACAAAGG + Intronic
1117320511 14:54618438-54618460 CTACTGAGAAGCAATCACAAAGG + Intronic
1117856521 14:60040007-60040029 CTACTGGGTACATAACAAAATGG - Intronic
1119154963 14:72401620-72401642 CTACTGAGAAAAAAAAAAAAAGG + Intronic
1119644018 14:76335621-76335643 CCACTGTGTACAAGACACAAGGG - Intronic
1120487607 14:85134053-85134075 CTTCAGAGGACAAAACATACAGG - Intergenic
1122850881 14:104530094-104530116 CTGATGAAGACAAAACTCAAGGG + Intronic
1124725298 15:32151234-32151256 GTACTGAGGACAGAACCAAATGG - Intronic
1124936492 15:34177198-34177220 CTTCTTAGGACAATACACTAAGG - Intronic
1125275239 15:37981942-37981964 CTACTGTGGTCAAATCATAAGGG - Intergenic
1125497588 15:40211702-40211724 CTAGTGAGTATAAAACAGAAGGG - Intronic
1125872912 15:43118489-43118511 CTAAAGAGGAAATAACACAAAGG - Intronic
1127149149 15:56055708-56055730 CTACTGAAGACAAGACAGCATGG + Intergenic
1127187196 15:56492238-56492260 ATACTGAGGATAATTCACAATGG - Intergenic
1127791886 15:62405557-62405579 CTAAGTAGGACAAAACACATTGG - Intronic
1129658072 15:77537785-77537807 GAACTGAGGACAGAACAGAAAGG + Intergenic
1130966553 15:88701484-88701506 CCACTGAGGACAAACCTTAATGG + Intergenic
1131669701 15:94606843-94606865 CCACTGAGGAAAAAAAAAAAAGG + Intergenic
1131867163 15:96723404-96723426 CTACAGAGAACATAACAGAAAGG + Intergenic
1132426442 15:101721867-101721889 GTACTGAGTGAAAAACACAATGG - Intronic
1133618042 16:7497608-7497630 CTACTGGGGACCAGACACAGTGG + Intronic
1135983054 16:27163664-27163686 CTACTGTGGATAAAGCAAAATGG + Intergenic
1137338324 16:47573057-47573079 CTAGTGATGAGAAGACACAAGGG - Intronic
1138887546 16:61097779-61097801 CTACTGTGGACAGAAAATAAAGG + Intergenic
1140279972 16:73545063-73545085 CTTCAGAGCACGAAACACAAAGG + Intergenic
1143404747 17:6669902-6669924 CTACAGAGGCCAAACCAGAAAGG - Intergenic
1143950374 17:10627866-10627888 TTACTGATGACAATAAACAAAGG + Intergenic
1147775146 17:42895583-42895605 CTACCGAGGACAAAATAATAGGG + Intergenic
1148827277 17:50403164-50403186 TGATTGAGGAAAAAACACAATGG - Intergenic
1150465898 17:65392436-65392458 ATGCTGAGTACAAAACAAAAAGG + Intergenic
1150782255 17:68133610-68133632 CTGCTGAGGGCCAAGCACAAAGG - Intergenic
1152200339 17:78941942-78941964 CGACTGAAAACTAAACACAAGGG + Intergenic
1154400653 18:14033588-14033610 ATAATGAGGACAAAACCCCAAGG - Intergenic
1155018238 18:21868274-21868296 CCACTGAGGAGAAAACAAAAAGG - Exonic
1155717968 18:28970309-28970331 GTACTGATGGCAAAACAGAAAGG + Intergenic
1160108131 18:75998775-75998797 CTTCTGAAAACTAAACACAAAGG - Intergenic
1163277918 19:16297061-16297083 CTGATGAGGACAAAAGCCAATGG + Intergenic
1166514812 19:43438418-43438440 CTACAGGGGAAAAAACCCAAAGG + Intergenic
1166908246 19:46130869-46130891 TTACTGAGAAACAAACACAAAGG - Intergenic
1168013570 19:53554106-53554128 CTACTCAGGCCCAAACACACAGG - Intronic
925796716 2:7553597-7553619 CTACTGAAGAAAAAAGACAAGGG - Intergenic
927541557 2:23916377-23916399 CTACCAAAAACAAAACACAATGG + Intronic
930005701 2:46894816-46894838 CTTCTGAGGACTAAGGACAAAGG - Intergenic
930012893 2:46951156-46951178 CTACTGAGTACAAGACACTGAGG + Intronic
931340010 2:61391620-61391642 CTATTGAAGCCAAAACACCATGG + Intronic
931944165 2:67286744-67286766 ATGCTGGGGACATAACACAAAGG - Intergenic
932201581 2:69832854-69832876 CTACTGAGGACAAAACGCTAAGG + Intronic
935030352 2:99315789-99315811 CAACTGACTACAAAACACAAGGG + Intronic
935361772 2:102251420-102251442 CTACTGAGGGCAAAACTACAGGG - Intergenic
936761461 2:115789677-115789699 ATACTGTGTACAAAACAAAAAGG + Intronic
936949825 2:117966683-117966705 GTACTTATGAAAAAACACAAAGG - Intronic
937647590 2:124283289-124283311 CTCCTCAGGACACACCACAATGG + Intronic
939308504 2:140440563-140440585 TTATTGAGGACAAAAGAGAAGGG + Intronic
939658929 2:144863354-144863376 CTGCTGGGAACAAAACACTATGG - Intergenic
939702771 2:145414382-145414404 CTTCTAAGCACAAAACCCAAAGG + Intergenic
940200964 2:151150330-151150352 TAAATGAGGACAAAACCCAAAGG + Intergenic
940589448 2:155702596-155702618 AAACTGAAGACAAAACAAAAAGG - Intergenic
941540189 2:166772384-166772406 TTACTGAGGACAAATCATAGTGG - Intergenic
944208377 2:197181301-197181323 CTACTGAAAACAAAATAAAATGG + Intronic
944502109 2:200372460-200372482 CCAGTGAGGACAAACCACCATGG - Intronic
945017955 2:205539661-205539683 CTACTGAGGAAATAATACAAAGG - Intronic
945036384 2:205707394-205707416 CTACTGTGCAAAAAACACCATGG - Intronic
945848952 2:214982628-214982650 ATACTCAGAAAAAAACACAAAGG + Intronic
1169971096 20:11270344-11270366 CTACTGAAGACAAAACCCGCCGG - Intergenic
1172323814 20:34018839-34018861 CAACTGAAGAAAAAACTCAAAGG - Intronic
1173040045 20:39453763-39453785 CTACTGAGACTAAAACACAGAGG - Intergenic
1177011540 21:15736053-15736075 CTACTGACGACAAAACAAGCAGG - Intronic
1177278348 21:18945703-18945725 CTACTGAGAAAAAAAGAAAATGG - Intergenic
1177685643 21:24434339-24434361 CATCTGAGGACAGAAAACAAAGG - Intergenic
1182021305 22:27083833-27083855 CCACTGTGATCAAAACACAATGG + Intergenic
1185427960 22:50784099-50784121 CTTCTGAAGAAAACACACAAGGG + Intergenic
950694788 3:14690604-14690626 CTACTGAGGAAGACACACACAGG + Intronic
950803851 3:15579652-15579674 CTGCTGAAAACAAAAGACAAAGG + Intronic
951001049 3:17560070-17560092 CTCCTGATGAGAAAATACAATGG + Intronic
952194572 3:31060948-31060970 CCACGGAGGACAGAAAACAATGG - Intergenic
952674367 3:36009276-36009298 CTGAAGAGGACACAACACAATGG + Intergenic
953243995 3:41174608-41174630 CTACTGTGGAGAAAGCACATTGG - Intergenic
954015439 3:47685303-47685325 CTACTCAGAATAACACACAACGG + Intronic
954072996 3:48156858-48156880 CTACTGGGGACAAAATATATTGG - Intergenic
955061746 3:55498509-55498531 CTACTGAAGAAAGAAGACAAAGG + Intergenic
955478774 3:59367883-59367905 CTACTGGGGTCAAAATAAAAGGG - Intergenic
960839556 3:121942937-121942959 CTACAGGGGAAAAAAAACAATGG - Exonic
961328172 3:126123658-126123680 CCACTCAGGAGAACACACAAGGG + Intronic
962252587 3:133845399-133845421 CCACTGAGGACACAGCATAAAGG + Intronic
963209810 3:142676372-142676394 CTACTGACTCCAAAAGACAATGG - Intronic
969089058 4:4679538-4679560 CTACTGTGTGCAAAGCACAAGGG + Intergenic
970424762 4:15935909-15935931 CTAATGAGGTCAAAAGAGAACGG - Exonic
972229353 4:37053429-37053451 CTACTGAGCAAATAACAAAATGG + Intergenic
973925800 4:55736067-55736089 ATAATGAGGACAAATGACAATGG - Intergenic
974852874 4:67424987-67425009 CAACTAAGAACAAAAGACAATGG + Intergenic
975393105 4:73843000-73843022 CTTCTGAGGAATAAACAGAAAGG - Intronic
978337121 4:107681398-107681420 GTAGTATGGACAAAACACAAGGG + Intronic
979799489 4:124890624-124890646 CTACTGAGAACAGAATACCAAGG - Intergenic
979882516 4:125979555-125979577 CTACTGAGGAGAACGCAAAATGG + Intergenic
980211936 4:129800145-129800167 CTACAGAGGACAATGAACAAGGG + Intergenic
980619731 4:135284810-135284832 ATACTGAGAAAAAAACACTAGGG - Intergenic
984543491 4:181070509-181070531 CTACTGAGGACACAGCTAAAAGG - Intergenic
984654625 4:182304596-182304618 CTGCTGTGTACAAGACACAAAGG + Intronic
984955410 4:185040584-185040606 CTACTGGGGAGAAATCACAAGGG + Intergenic
988523781 5:31968719-31968741 CATATGAAGACAAAACACAAAGG + Intronic
988860616 5:35274008-35274030 TCACTGAGGACATAAAACAAAGG + Intergenic
989451663 5:41593641-41593663 CTACTAAGGACAAAACAGGCTGG - Intergenic
990007095 5:50956242-50956264 CTAGAGAGTTCAAAACACAAGGG - Intergenic
990964262 5:61428120-61428142 CTACAGTGGACAGTACACAAGGG + Intronic
992092129 5:73326770-73326792 CTACACAAAACAAAACACAAAGG - Intergenic
992482773 5:77168062-77168084 CAACAGAGGAAAAAATACAATGG - Intergenic
993194128 5:84719147-84719169 CTACTGTAGACAAAACAGCATGG + Intergenic
994534812 5:101015959-101015981 CTCCTGGGGAAAAAACATAAGGG - Intergenic
995645060 5:114302394-114302416 CTACTGCAGACAAAATATAAAGG + Intergenic
995962566 5:117860705-117860727 CTTCTGATGACAATGCACAAAGG + Intergenic
996188089 5:120504352-120504374 CTAGTGGAGACAAAACAAAAGGG + Intronic
996401568 5:123068803-123068825 CTTCTGAGGGCCAAACATAAAGG - Intergenic
996522337 5:124441262-124441284 CTACTGAATCCAAAACACTAGGG - Intergenic
996754848 5:126924712-126924734 CTTCTGAGAACAGGACACAAAGG + Intronic
997076964 5:130690287-130690309 CCACTGAGTGCCAAACACAATGG + Intergenic
1000520436 5:162288313-162288335 CCACTCAGGAGAAAGCACAAAGG - Intergenic
1000784197 5:165523845-165523867 CTTCTGAAGCCAAAACTCAAAGG - Intergenic
1001873745 5:175181328-175181350 CTAGTGCAGACAAATCACAAAGG + Intergenic
1002492148 5:179586259-179586281 CTCCTGAGGCCAAAGCAGAAGGG - Intronic
1004212337 6:13661891-13661913 CAACTGATGACGAAAAACAATGG + Intronic
1004236622 6:13880268-13880290 TCACTGAGGAAAAAACACAATGG + Intergenic
1004242833 6:13942788-13942810 CTAAAGAGGAAAAAATACAATGG - Intronic
1013725125 6:113085704-113085726 CTACTGAGTAAAAAATACAATGG + Intergenic
1013945813 6:115720950-115720972 ATACTGAAGAGAAAAAACAATGG - Intergenic
1014253526 6:119139166-119139188 CCACTGAGAACAAAACTAAAAGG - Intronic
1014725436 6:124966065-124966087 ATACTTAAGACAAAAGACAAAGG + Intronic
1018108745 6:160514133-160514155 CTCCTGAATACAACACACAATGG - Intergenic
1020886461 7:13824212-13824234 TTCTTGAGGACCAAACACAAGGG + Intergenic
1023660147 7:42462673-42462695 CTGCTGAGGACAAAGCAGAGGGG - Intergenic
1024683570 7:51719650-51719672 CTACTGATGATACCACACAAAGG + Intergenic
1028474412 7:91238058-91238080 CTTCTTATGACAAAACCCAAGGG + Intergenic
1032502945 7:132413556-132413578 CAACTCAGAGCAAAACACAATGG + Intronic
1034208707 7:149343087-149343109 TTACTGAGTACATAACAAAATGG - Intergenic
1035984500 8:4411893-4411915 CTTCTGAGGTCAATACACATAGG + Intronic
1037696355 8:21227537-21227559 GGACTTAGGACAAAACACAGAGG - Intergenic
1037800137 8:22028746-22028768 TTGCTGAGGCCAGAACACAAAGG - Intronic
1037813351 8:22099244-22099266 GTAATGAGGGCAAAACACATTGG + Intronic
1038022242 8:23560488-23560510 ATACAGAGGAGAAAAAACAATGG - Intronic
1041298402 8:56386290-56386312 CTACTGATGACAAAACTCAATGG - Intergenic
1041516590 8:58706266-58706288 ATACTTAGCAAAAAACACAAAGG - Intergenic
1041539529 8:58967351-58967373 TTATAGATGACAAAACACAAGGG + Intronic
1041761204 8:61368489-61368511 CTACTGAGGACAAAACACAAAGG - Intronic
1042328293 8:67551401-67551423 CTACTGTGGCCAAAACAGCATGG - Intronic
1043948845 8:86285034-86285056 CTAATGTGGTCAAAAGACAATGG + Intronic
1043982979 8:86661974-86661996 CTCCTGTGGACAAGACACCACGG - Intronic
1045052004 8:98335955-98335977 CTTCTGAGGACAAAACTCCTTGG - Intergenic
1045576340 8:103424609-103424631 CTACTGAGTACAAACCTCAGCGG - Intronic
1046361535 8:113164849-113164871 TTTCTTAGCACAAAACACAAAGG + Intronic
1046690431 8:117278405-117278427 TCACAGAAGACAAAACACAATGG - Intergenic
1047872357 8:129098131-129098153 CTGCTCAGGAGAAAACACAAAGG + Intergenic
1047953049 8:129951395-129951417 CAACTGAGGACATAAGAAAATGG + Intronic
1048197888 8:132347505-132347527 ATACTTAAGACAATACACAATGG + Intronic
1048538106 8:135316456-135316478 TTACTGAGGACAATGCACATAGG - Intergenic
1051720535 9:20032540-20032562 CTGCAGAGAACAAAAAACAATGG - Intergenic
1051834311 9:21317866-21317888 CTACTGAGTAAAAAGCACAAGGG + Intergenic
1051962727 9:22788118-22788140 CTACAGTGGCCAAAACACCATGG + Intergenic
1052138164 9:24941724-24941746 CTACTTTGCGCAAAACACAAGGG - Intergenic
1052288435 9:26814891-26814913 CTACTTAAAACAAAAGACAAAGG + Intergenic
1052350322 9:27451934-27451956 CAACTGAGGGCAAATCACAGAGG + Intronic
1052602624 9:30655487-30655509 ATACTAAGCACAAAAAACAAAGG - Intergenic
1055435590 9:76288936-76288958 TTACTGAGAACAAAATAAAATGG + Intronic
1055829969 9:80366809-80366831 CTAGTGAGGCCAAAACCAAACGG + Intergenic
1055902146 9:81252851-81252873 CTTCTGAGGACACAACAAGAAGG + Intergenic
1056273857 9:84973698-84973720 CAACTGAGGCCCAGACACAAAGG - Intronic
1060594982 9:124842209-124842231 CTAATCAGAATAAAACACAAAGG - Intergenic
1060965257 9:127708810-127708832 CCACTGAGGAGAAAACACCAAGG + Intronic
1061435298 9:130557529-130557551 CTAGTGAGAACTAAACACCAGGG + Intergenic
1061739100 9:132686464-132686486 CTAAGGAGCAGAAAACACAAAGG - Intronic
1062094316 9:134695129-134695151 CTACAGAGGACAAAATAGAGAGG - Intronic
1185855635 X:3532261-3532283 CTTCTTAGGACAAATCAGAAAGG + Intergenic
1186951370 X:14629123-14629145 CTACTGAAGACACATCATAAGGG + Intronic
1188791259 X:34410718-34410740 CTACTGTAATCAAAACACAATGG + Intergenic
1190095893 X:47480805-47480827 ATTCTGAGGGCCAAACACAAGGG - Intronic
1190995068 X:55599293-55599315 ACACTGAGGGCAAAAAACAATGG - Intergenic
1192056592 X:67779995-67780017 CTAGAGAGGCCAAAACACAATGG + Intergenic
1194548729 X:95271102-95271124 CTACTTAGTTCAAAACACAAAGG + Intergenic
1194588364 X:95766065-95766087 ATTCTGAGGTCAAAACACAATGG + Intergenic
1195128802 X:101835218-101835240 CTTCTGAGGGAAAAAGACAAAGG + Intronic
1199332542 X:146579717-146579739 CTACAGAAAACAAAACAGAATGG + Intergenic
1201302496 Y:12521636-12521658 CTACTGGGTACATAACAAAATGG - Intergenic
1201863830 Y:18628417-18628439 CTACTGAGTGCAAAACTGAAGGG + Intergenic
1201869492 Y:18691961-18691983 CTACTGAGTGCAAAACTGAAGGG - Intergenic