ID: 1041761210

View in Genome Browser
Species Human (GRCh38)
Location 8:61368509-61368531
Sequence TAGCATTGGTCAGATAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041761204_1041761210 -3 Left 1041761204 8:61368489-61368511 CCTTTGTGTTTTGTCCTCAGTAG 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1041761210 8:61368509-61368531 TAGCATTGGTCAGATAGGGGTGG No data
1041761203_1041761210 -2 Left 1041761203 8:61368488-61368510 CCCTTTGTGTTTTGTCCTCAGTA 0: 1
1: 1
2: 0
3: 34
4: 350
Right 1041761210 8:61368509-61368531 TAGCATTGGTCAGATAGGGGTGG No data
1041761202_1041761210 22 Left 1041761202 8:61368464-61368486 CCTTGTTCTTGGACAAGAACATT 0: 1
1: 0
2: 5
3: 40
4: 508
Right 1041761210 8:61368509-61368531 TAGCATTGGTCAGATAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041761210 Original CRISPR TAGCATTGGTCAGATAGGGG TGG Intronic
No off target data available for this crispr