ID: 1041768809

View in Genome Browser
Species Human (GRCh38)
Location 8:61450428-61450450
Sequence ACTCACATCCTACACTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 179}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041768809_1041768817 29 Left 1041768809 8:61450428-61450450 CCTCAGCAGTGTAGGATGTGAGT 0: 1
1: 0
2: 0
3: 18
4: 179
Right 1041768817 8:61450480-61450502 ATAAAAATCACAGAGGGCCCTGG No data
1041768809_1041768812 4 Left 1041768809 8:61450428-61450450 CCTCAGCAGTGTAGGATGTGAGT 0: 1
1: 0
2: 0
3: 18
4: 179
Right 1041768812 8:61450455-61450477 CTGGTTAGAGAAGGCAAGAAAGG No data
1041768809_1041768816 23 Left 1041768809 8:61450428-61450450 CCTCAGCAGTGTAGGATGTGAGT 0: 1
1: 0
2: 0
3: 18
4: 179
Right 1041768816 8:61450474-61450496 AAGGGGATAAAAATCACAGAGGG No data
1041768809_1041768813 5 Left 1041768809 8:61450428-61450450 CCTCAGCAGTGTAGGATGTGAGT 0: 1
1: 0
2: 0
3: 18
4: 179
Right 1041768813 8:61450456-61450478 TGGTTAGAGAAGGCAAGAAAGGG No data
1041768809_1041768814 6 Left 1041768809 8:61450428-61450450 CCTCAGCAGTGTAGGATGTGAGT 0: 1
1: 0
2: 0
3: 18
4: 179
Right 1041768814 8:61450457-61450479 GGTTAGAGAAGGCAAGAAAGGGG No data
1041768809_1041768815 22 Left 1041768809 8:61450428-61450450 CCTCAGCAGTGTAGGATGTGAGT 0: 1
1: 0
2: 0
3: 18
4: 179
Right 1041768815 8:61450473-61450495 AAAGGGGATAAAAATCACAGAGG No data
1041768809_1041768811 -5 Left 1041768809 8:61450428-61450450 CCTCAGCAGTGTAGGATGTGAGT 0: 1
1: 0
2: 0
3: 18
4: 179
Right 1041768811 8:61450446-61450468 TGAGTAGAACTGGTTAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041768809 Original CRISPR ACTCACATCCTACACTGCTG AGG (reversed) Intronic
901157436 1:7149963-7149985 TCTCATTTCCTTCACTGCTGGGG + Intronic
901313017 1:8284180-8284202 ACAAATATCCTACACTGCTGTGG - Intergenic
902132973 1:14279927-14279949 ACTCACCTTCTAAACTGGTGGGG - Intergenic
904239825 1:29136710-29136732 ACTCCACTCCCACACTGCTGCGG - Intergenic
906293933 1:44637536-44637558 GCTCACATCCTCCATTGCTGTGG + Intronic
907182311 1:52581555-52581577 ATTATCATACTACACTGCTGAGG + Intergenic
909494086 1:76258690-76258712 AGTCACATCTTACAATGCCGGGG - Intronic
911257236 1:95646617-95646639 ACTAAAATCCTCCTCTGCTGAGG + Intergenic
913177578 1:116288937-116288959 ACTCACATCCTACCCTGTTTGGG - Intergenic
915080013 1:153345615-153345637 ACTCATCTCCTCCCCTGCTGTGG + Intronic
915228804 1:154430526-154430548 ACTCACAAACAACATTGCTGAGG - Exonic
915978355 1:160405289-160405311 ACTCACATTCTACCCTACGGCGG + Intronic
916688299 1:167167639-167167661 ACTCTGATCCTAGAATGCTGGGG - Intergenic
918958329 1:191238678-191238700 ACTAAAATCCTCCTCTGCTGAGG - Intergenic
1063054421 10:2488684-2488706 ACTTTCACCCTTCACTGCTGGGG + Intergenic
1063098785 10:2931709-2931731 ACTCACATTCCACATAGCTGGGG - Intergenic
1064954377 10:20891524-20891546 ATTCACATTCTTCACTGCAGTGG + Intronic
1068082535 10:52337701-52337723 CCATTCATCCTACACTGCTGAGG - Intergenic
1068090631 10:52428708-52428730 ACTCACCTCCTGCTGTGCTGTGG + Intergenic
1068484865 10:57644949-57644971 AAGCACATCCTAAATTGCTGGGG - Intergenic
1068522100 10:58088085-58088107 TCTCACTTCCTCCACTCCTGAGG - Intergenic
1070057558 10:72950252-72950274 ACTGACCTCCTAGTCTGCTGGGG - Intronic
1072095129 10:92170924-92170946 ACTCAATTCCTACACTGTTCAGG + Intronic
1072449120 10:95525318-95525340 ACTCACACTGTACCCTGCTGTGG + Intronic
1075602874 10:123783545-123783567 ACTCACATCCTACCCTCCAAGGG - Intronic
1075967112 10:126622545-126622567 GCTAACATCCTACAGTGCTCAGG + Intronic
1076099107 10:127759649-127759671 ACTAACATCTTACACTGGTATGG + Intergenic
1079476267 11:20832866-20832888 ACTCTCATCCTCCAGTACTGTGG + Intronic
1084452567 11:69248544-69248566 ACTAACATCCTGCATTGGTGTGG + Intergenic
1084937556 11:72595239-72595261 ACGCACCTCCTTCTCTGCTGAGG - Intronic
1091018208 11:132073399-132073421 ACTAACATCATGCACTGCTGGGG - Intronic
1093661800 12:21766049-21766071 ACGAACCTCCTACATTGCTGAGG - Exonic
1094410541 12:30163955-30163977 ATTCAAATCCTACAGTGCTGTGG + Intergenic
1094516110 12:31128549-31128571 AATCAAAGCTTACACTGCTGAGG - Intergenic
1094596804 12:31873434-31873456 ACTCACCTGCTGCTCTGCTGTGG + Intergenic
1097308247 12:58092485-58092507 AGTCACATCCTATTCTCCTGTGG + Intergenic
1097951205 12:65430094-65430116 ACTTACATCCTTCAGTGCTCAGG - Intronic
1099447393 12:82768556-82768578 ATTTACATCCCACAATGCTGGGG + Intronic
1101907484 12:108838544-108838566 AGTCACATCCTGCAGGGCTGCGG - Intronic
1103342158 12:120226417-120226439 AGTCACATCCCACACTGCCAAGG + Intronic
1104175737 12:126330743-126330765 ACTCTCACCCAACACTGCTTTGG - Intergenic
1104422403 12:128647431-128647453 ACTCACATCCAACGCTGATAGGG - Intronic
1104628888 12:130382489-130382511 ACTCACATCAGAAACTGCCGTGG - Intergenic
1105929805 13:25041740-25041762 ACCCAGATCCTCCCCTGCTGTGG - Intergenic
1106127972 13:26916233-26916255 ATTAACATCTTACACTGGTGTGG + Intergenic
1106636453 13:31533741-31533763 AGTCACATTCTAAACTACTGGGG + Intergenic
1107795695 13:44049280-44049302 ACACACATCCTTGACTGCTGTGG - Intergenic
1107950617 13:45458306-45458328 CCTCCCATCATACACTGCTGGGG - Intergenic
1109293319 13:60500836-60500858 ACTAAAATCCTCCTCTGCTGAGG - Intronic
1109338937 13:61029310-61029332 ACTCACTGCCTTCTCTGCTGAGG + Intergenic
1110607359 13:77448321-77448343 AGTGACATCATACACTGTTGAGG - Intergenic
1113156908 13:107333507-107333529 ACTCACATTTTTCACTGCTCTGG + Intronic
1115732279 14:36284330-36284352 AATCACTTCCTACACTGCAAAGG + Intergenic
1117024012 14:51601323-51601345 AATCACATCCTACACCCCTGGGG - Intronic
1121214499 14:92236874-92236896 ACTCACATCCTAATCACCTGGGG + Intergenic
1122706029 14:103622214-103622236 ACTAACATCCTGCACTAGTGTGG - Intronic
1124029473 15:25996892-25996914 ACTCACATTCCACATGGCTGGGG + Intergenic
1124722356 15:32121114-32121136 CCCCACACCCTGCACTGCTGAGG - Intronic
1124836923 15:33204409-33204431 AATCACATAGTACAGTGCTGAGG + Intergenic
1126079547 15:44946016-44946038 ACTCACATCTTACATTGTTAGGG - Intergenic
1128389194 15:67171714-67171736 AGTCACATCCCACACTGCCCAGG - Intronic
1128963717 15:72036534-72036556 ACCAACATCCTACAATGATGGGG + Intronic
1128989118 15:72243940-72243962 ACTGACATTCTTCACTGCTCAGG + Intronic
1131974882 15:97934504-97934526 AGTCACATTCTGCATTGCTGGGG + Intergenic
1132469210 16:92590-92612 ACTCACCTCCTGCACAGCGGGGG + Exonic
1133280973 16:4665093-4665115 AGTCACTTCCACCACTGCTGGGG - Exonic
1136590320 16:31214587-31214609 CCTCACATCCTACACTGGATGGG - Intronic
1139716273 16:68815706-68815728 AATCACATCCTACACTGCCCAGG + Exonic
1144522854 17:15965757-15965779 AGCCACATCCTAGCCTGCTGGGG + Intronic
1145877874 17:28333479-28333501 ACCCACATCCAACACTGCATGGG + Intronic
1148800383 17:50221279-50221301 ACTCCCATCCCACCCTCCTGAGG + Intergenic
1150463411 17:65371739-65371761 ATTCACATCATAGACTGCTAGGG + Intergenic
1151081318 17:71332935-71332957 ACAGTCATCCTACTCTGCTGTGG - Intergenic
1151232093 17:72692335-72692357 GCTCAAATCCTACAATGATGAGG + Intronic
1151834139 17:76572412-76572434 ATTCACATCCCATACTGCAGAGG + Intronic
1152731262 17:81971963-81971985 CCGCCCATCCTACACTTCTGGGG + Intergenic
1155762400 18:29584311-29584333 ACTCACAGCCTTGACAGCTGAGG + Intergenic
1156479102 18:37425045-37425067 GGTCACATCCTATATTGCTGTGG + Intronic
1158107729 18:53904693-53904715 ACTCACAGCCTTTTCTGCTGGGG + Intergenic
1163644885 19:18483534-18483556 ACTCTCATCCTAAACTGCATGGG + Intronic
1167300128 19:48673178-48673200 ACTCACGTCCCACACCGTTGCGG - Intergenic
925754018 2:7116593-7116615 CTTCTCATCCTACACTGCAGAGG + Intergenic
927089689 2:19700933-19700955 TCTCACATCCTACACTGCCAGGG + Intergenic
927849887 2:26492281-26492303 GCTCACATCCTACACAGCACAGG + Intronic
928349276 2:30533562-30533584 ATTCATATCCTTCAATGCTGTGG - Intronic
928386170 2:30870217-30870239 ACTCACATCCTAGGCAGCTGAGG - Intergenic
929687105 2:44044527-44044549 TCTCACATCAGACACTTCTGGGG - Intergenic
933822368 2:86125187-86125209 ACTAACATCCTACAATGCACAGG - Intronic
933841095 2:86286174-86286196 ACCCACCTCCTCCACAGCTGTGG + Intronic
934784454 2:96994974-96994996 ACTCACACCCTAGACTTCTGGGG + Intronic
934876808 2:97929188-97929210 ACCCAAATCCTACACTGATGGGG + Intronic
935129807 2:100253287-100253309 ACTCACATTCTACGGAGCTGGGG - Intergenic
935234549 2:101127435-101127457 ACTCACTTCATACACCACTGAGG + Intronic
935329004 2:101962570-101962592 ACTCACATACTGCCCTGCTCCGG - Intergenic
939184374 2:138843011-138843033 AGCCATATCCTACATTGCTGGGG + Intergenic
940037499 2:149326353-149326375 ACTCTCATACCACACTGGTGAGG - Intergenic
941816659 2:169802597-169802619 TCTCAAATCCTACTCTTCTGAGG + Intronic
942794186 2:179796758-179796780 ACTCAAAGCCTCCACTCCTGTGG + Intronic
946201721 2:218074379-218074401 ACTCACATCCAGCACTGCACAGG + Intronic
946337034 2:219044755-219044777 ACTCACCTCACTCACTGCTGAGG - Intergenic
948293401 2:236843981-236844003 ACTCACACAATCCACTGCTGTGG + Intergenic
948602307 2:239114334-239114356 AATCAAATCCTACAGAGCTGTGG + Intronic
1169102178 20:2960025-2960047 ATCCACATCCTACACCACTGTGG + Intronic
1169252162 20:4069082-4069104 ACACACAGCCTTCAGTGCTGAGG - Intergenic
1176929399 21:14790087-14790109 ACTCACATTTTACATGGCTGGGG + Intergenic
1177059846 21:16357479-16357501 ACACACACCCCACACGGCTGAGG - Intergenic
1178135793 21:29625954-29625976 AGTCACATTCTAAGCTGCTGGGG - Intronic
1178667454 21:34561167-34561189 ACTCACAGTCTGCATTGCTGGGG - Intronic
1179032839 21:37735452-37735474 ATTCAGAGCCTACAGTGCTGAGG - Intronic
1181283157 22:21734339-21734361 TACCCCATCCTACACTGCTGTGG - Intronic
1182022703 22:27094523-27094545 ACACACATCCTACCCTTGTGAGG - Intergenic
1184710421 22:46246392-46246414 ACTCCCATGCCACACTGCGGAGG + Intronic
1185047386 22:48535209-48535231 ACACACATACTACAGTGGTGGGG - Intronic
1185345902 22:50310507-50310529 AGTCACATCCTGCACTGAAGTGG + Exonic
949857956 3:8479077-8479099 ACTCACATTCCACATGGCTGGGG + Intergenic
950841178 3:15969809-15969831 ACTCCCTCCCTCCACTGCTGAGG - Intergenic
950874922 3:16263168-16263190 ACTCTCATCCTGCTCTGCTCTGG + Intronic
956806363 3:72817090-72817112 ACACACATGCAACTCTGCTGGGG + Intronic
960659935 3:120046330-120046352 ACTAACATCTTGCAATGCTGTGG - Intronic
960831126 3:121849629-121849651 CCTCAAATCCTACACTTATGAGG + Intronic
962182639 3:133224690-133224712 ACTCACGTTCCACACGGCTGGGG - Intronic
966445786 3:179999278-179999300 ATTAACATCCTCCTCTGCTGAGG - Intronic
967455852 3:189685791-189685813 ATTCACATCCTACATGTCTGGGG - Intronic
968392116 4:202256-202278 ACTCACATTCCACATTGCTGGGG - Intergenic
969116445 4:4873252-4873274 ACTCAGATCCTGCGCTGCTGCGG - Intergenic
970123158 4:12779834-12779856 AACCACTTCCTACACGGCTGGGG - Intergenic
970629379 4:17924220-17924242 ACTAAAATCCTTCTCTGCTGAGG - Intronic
973098130 4:46227402-46227424 ATTAAAATCCTACTCTGCTGAGG - Intergenic
973826243 4:54710103-54710125 ACCCAAGTCCTGCACTGCTGGGG + Intronic
974525906 4:63049881-63049903 AACCACAGCCTACCCTGCTGTGG - Intergenic
976551916 4:86406481-86406503 ACTCACCTCCTACACTGAGTTGG - Intronic
977119564 4:93081117-93081139 CATTACATCATACACTGCTGTGG - Intronic
982170481 4:152656449-152656471 AACCACATCCTAAGCTGCTGGGG + Intronic
983508238 4:168578533-168578555 ACTCACATTCAGCACAGCTGGGG - Intronic
986602649 5:9488628-9488650 AATCAATTCCTACACTGATGCGG + Intronic
987504485 5:18750555-18750577 ATTAAAATCCTCCACTGCTGAGG - Intergenic
988160732 5:27516151-27516173 ATTAAAATCCTCCACTGCTGAGG + Intergenic
992033368 5:72746642-72746664 AATCACAGCCTAACCTGCTGGGG + Intergenic
992798683 5:80276146-80276168 ATTCACATCTTGCACTCCTGTGG + Intergenic
994951976 5:106475204-106475226 ACTCACATCCTAACAGGCTGTGG - Intergenic
994976720 5:106817393-106817415 ATTCACATCCTAAATTGCTAGGG - Intergenic
995255252 5:110038447-110038469 ACTCACCTCCTAGACCGCAGTGG + Intergenic
998624515 5:143830933-143830955 ATTAACATCCTACATTGCTATGG - Intergenic
1000166220 5:158651197-158651219 AGTCACATTCTACATTACTGGGG + Intergenic
1001324430 5:170711611-170711633 ATTCACATCTTGCACTGGTGTGG - Intronic
1001980673 5:176035419-176035441 CATCAAATGCTACACTGCTGGGG - Intergenic
1002236789 5:177808646-177808668 CATCAAATGCTACACTGCTGGGG + Intergenic
1006868672 6:37230428-37230450 AGTCACATTCTGCAGTGCTGCGG - Intronic
1006944866 6:37778480-37778502 ACCCACATCCACCACTACTGAGG + Intergenic
1009660592 6:66606211-66606233 ATTCAGATCCTTCTCTGCTGAGG + Intergenic
1010378883 6:75205057-75205079 ACTCAGATCCTAGACTTGTGGGG - Intronic
1015921192 6:138268030-138268052 ACTCTCTTCCATCACTGCTGTGG + Intronic
1015974692 6:138777929-138777951 CCCCCCATCCCACACTGCTGTGG - Intronic
1016309983 6:142723896-142723918 ACTCTGAAGCTACACTGCTGGGG - Intergenic
1016576169 6:145571870-145571892 ATTAACATCCTCCTCTGCTGAGG + Intronic
1016715222 6:147218721-147218743 TCTCACATCCCAAAGTGCTGGGG + Intronic
1018253569 6:161896033-161896055 TCTCTCCTCCAACACTGCTGAGG - Intronic
1018954959 6:168403280-168403302 ACTAAACTCCTACTCTGCTGAGG + Intergenic
1019170185 6:170129438-170129460 ACTCACATCCTGCTCTGCAGAGG + Intergenic
1024486011 7:49920550-49920572 CCTTACATCCTTCACTGCTTAGG - Exonic
1026987570 7:74564398-74564420 ACTCTCACCCTACACTGGGGAGG - Intronic
1028141831 7:87282702-87282724 ATTAAAATCCTCCACTGCTGAGG - Intergenic
1033519388 7:142145640-142145662 GCTCACATCATACTCTGATGAGG + Intronic
1034293036 7:149947453-149947475 ACTCACATCCTCCTATGCTGGGG + Intergenic
1034813037 7:154149420-154149442 ACTCACATCCTCCTATGCTGGGG - Intronic
1035305284 7:157927855-157927877 ACGCACACCCTTCACAGCTGAGG + Intronic
1035810908 8:2490257-2490279 ACTCACATCTTACATGGCAGTGG + Intergenic
1036493834 8:9251704-9251726 AATCATATCCAACACTGATGGGG + Intergenic
1036676064 8:10834260-10834282 AATTACATCCAGCACTGCTGAGG + Intronic
1037857824 8:22384188-22384210 ACACACATCCTGAAATGCTGGGG - Intronic
1041768809 8:61450428-61450450 ACTCACATCCTACACTGCTGAGG - Intronic
1041971812 8:63752043-63752065 ACTCACATGTTTCCCTGCTGTGG + Intergenic
1042621906 8:70716410-70716432 ACTCACATTCTGCAGGGCTGCGG + Intronic
1044072838 8:87784216-87784238 ACTTACATTCTACATGGCTGGGG + Intergenic
1046181544 8:110655663-110655685 ACTCACCTCATACATTGCTATGG + Intergenic
1050953446 9:11626391-11626413 ACTCACATTCTGCATGGCTGGGG - Intergenic
1055235753 9:74120837-74120859 ACTCTCATCCTACCATGTTGAGG - Intergenic
1060021727 9:120137319-120137341 ACTCTCCTCTTGCACTGCTGTGG - Intergenic
1062314352 9:135958874-135958896 ACTCAGATCCTCCACACCTGTGG + Intronic
1185538555 X:883786-883808 GCTCACACCCTGCACAGCTGGGG - Intergenic
1185908736 X:3962757-3962779 GATCACAGCCTACCCTGCTGAGG + Intergenic
1185908759 X:3962950-3962972 GATCACAGCCTACCCTGCTGAGG + Intergenic
1187792624 X:22967658-22967680 ACTAACACACTACACTTCTGTGG - Intergenic
1188052815 X:25508494-25508516 ACTCACATTCCACATGGCTGGGG + Intergenic
1190150700 X:47944985-47945007 ACTCACATTCCACATGGCTGGGG - Intronic
1191629936 X:63311868-63311890 ACTAAAATCCTCCGCTGCTGAGG + Intergenic
1191769405 X:64739382-64739404 ATTCAAATCCTCCTCTGCTGAGG + Intergenic
1193250322 X:79282811-79282833 AGTCACATCTTACATTGCGGCGG + Intergenic
1194532478 X:95068715-95068737 ACCAATGTCCTACACTGCTGTGG - Intergenic
1195129953 X:101841704-101841726 ACTGACATCCTTCAATGCAGAGG + Exonic
1195176268 X:102318080-102318102 ACTGACATCCTTCAATGCGGAGG - Exonic
1195182596 X:102369013-102369035 ACTGACATCCTTCAATGCGGAGG + Exonic
1197304417 X:124823601-124823623 ACTCACATACTACTCTTTTGGGG - Intronic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1198395307 X:136213682-136213704 ACTAACACCCCACACTGCTTTGG - Intronic
1199642734 X:149880067-149880089 ACTCGGATCCTACATTGATGTGG - Intergenic
1199944815 X:152656775-152656797 ACTCGCATGGTACCCTGCTGTGG + Exonic
1202023309 Y:20491488-20491510 ACCCATATCCTATCCTGCTGTGG - Intergenic