ID: 1041773661

View in Genome Browser
Species Human (GRCh38)
Location 8:61499741-61499763
Sequence TTTTCCCCCAGTGAGGGGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041773657_1041773661 11 Left 1041773657 8:61499707-61499729 CCAAAGTTGGACAAAGACTTGAG 0: 1
1: 0
2: 0
3: 22
4: 301
Right 1041773661 8:61499741-61499763 TTTTCCCCCAGTGAGGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 179
1041773655_1041773661 27 Left 1041773655 8:61499691-61499713 CCATCGGTCTGAGCAGCCAAAGT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1041773661 8:61499741-61499763 TTTTCCCCCAGTGAGGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041773661 Original CRISPR TTTTCCCCCAGTGAGGGGAC TGG Exonic
900567879 1:3343403-3343425 TTTTTCCCCAATGAGTGGCCTGG + Intronic
903015364 1:20358120-20358142 TTTGCCCGCAGAGAAGGGACTGG - Intergenic
904418532 1:30377090-30377112 TTTTCCCCCACTGAGAGGGGAGG - Intergenic
905204509 1:36335543-36335565 TTTTTCCCCAGTGGGGGCTCTGG - Intergenic
907329160 1:53660139-53660161 TGTTCCCCCATTGAGGTGTCTGG - Intronic
908560552 1:65301869-65301891 TCTTCCCCCAGGGATGGGGCAGG + Intronic
910746986 1:90584464-90584486 ATTTCCCCCAGGTAGAGGACTGG - Intergenic
914478186 1:148041689-148041711 CTTTCCCACAGTGAGGGCAGGGG + Intergenic
915297493 1:154931519-154931541 GTTGCCCCCAGGGAGGGGACAGG - Intronic
916069089 1:161159656-161159678 CTGTCCCCCAGTGAGGCGGCGGG - Exonic
917190267 1:172409577-172409599 TTTTCCCCCAGTTTGGGGTTTGG - Exonic
917736490 1:177925801-177925823 TTTTCCCCCAAAGAGTGGAATGG - Intronic
917976960 1:180245877-180245899 TTTCCACCCAGTGAGGGCATGGG - Intronic
918115404 1:181491939-181491961 TGTAGCCCCAGGGAGGGGACAGG + Intronic
918833350 1:189428021-189428043 TTTTCCACCAGTGTGGGGGGTGG + Intergenic
921192987 1:212726196-212726218 TTTTCCCCCACTGATGTGAGAGG - Intronic
924239477 1:242027358-242027380 TCTGGCCCCAGTGAGGGGAAGGG + Intergenic
1063695915 10:8334772-8334794 TTTTCCACCACTGAGGACACAGG - Intergenic
1067008885 10:42691360-42691382 ATTTCTCCCAGTGTGGGGGCGGG - Intergenic
1067476904 10:46573293-46573315 CTGTCCCCCAGTGAGAGGAAGGG - Intergenic
1067617833 10:47768487-47768509 CTGTCCCCCAGTGAGAGGAAGGG + Intergenic
1068977137 10:63022277-63022299 TTCTCCCCAAGTGAGGGAAAAGG + Intergenic
1071722116 10:88157601-88157623 TTTCTCCCCAGTGTGGGGTCAGG - Intergenic
1074676223 10:115854498-115854520 TTTTCCCTAAGTGAGTGGAGAGG - Intronic
1075536648 10:123277038-123277060 TTTTCACCCAGTGGGGTGAGAGG - Intergenic
1075643207 10:124080144-124080166 TCTTCACCCAGAGACGGGACGGG + Intronic
1077029723 11:459594-459616 TTTTCCACCAGCGATGGGACAGG + Intronic
1077124626 11:926812-926834 TTTTCCCACCCCGAGGGGACAGG - Intronic
1077186041 11:1235869-1235891 CTTTCTCCCAGTGAGGGCCCGGG + Intronic
1081612052 11:44568644-44568666 GTTTCCCACAGTAGGGGGACTGG + Intronic
1082050611 11:47767536-47767558 TTTTGACCCAGAGAAGGGACCGG + Intergenic
1083638793 11:64134348-64134370 CATTCCCCCAGTGAGAGGCCAGG + Intronic
1084438351 11:69157008-69157030 TCATCCCCCAGGAAGGGGACCGG - Intergenic
1085085989 11:73667159-73667181 TATCCCCCCAGTAAGGGGACAGG + Intergenic
1085459598 11:76685559-76685581 ATTTCCCCAACTGAGGGGAGAGG - Intergenic
1086401073 11:86461304-86461326 TTGTCCCCCAGTGAGGGAGGGGG + Intronic
1087747608 11:101967397-101967419 TTTTCCCCCTGGGCGGGGAAGGG - Intronic
1088359942 11:108979254-108979276 TCTGCCCCCTGTGAGGGGTCAGG + Intergenic
1092081891 12:5723369-5723391 GTTTCCGCCAATGAGGGGAAGGG + Intronic
1101820297 12:108179057-108179079 TTGATCCTCAGTGAGGGGACAGG - Intronic
1101870939 12:108564763-108564785 GTTTCCCCCAATCTGGGGACAGG - Intronic
1102727918 12:115081781-115081803 GTTTCCCCCAGTTAGGGTAAGGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1108316582 13:49242849-49242871 TCTTCCACCAGTGAGGGCAAAGG - Intergenic
1110810316 13:79805574-79805596 CCCTCCCCAAGTGAGGGGACAGG + Intergenic
1117851537 14:59976298-59976320 TTTTCCCCCAGACTGGGGATGGG - Intronic
1119045510 14:71315155-71315177 TTTTCTCCGAGTGAGGTGAGAGG + Intergenic
1119159060 14:72438135-72438157 TTTTTCCCGAGAGAGGGGAATGG + Intronic
1120199148 14:81517819-81517841 TTTGCTGCCAGTGAGAGGACTGG + Intronic
1121565125 14:94903657-94903679 GTTTCCCCCTGTGGTGGGACTGG + Intergenic
1122641716 14:103163952-103163974 CTTTCCACCAGTGAGGGCAGAGG - Intergenic
1122643355 14:103175503-103175525 CTTTCCACCAGTGAGGGCAGAGG - Intergenic
1122828898 14:104385995-104386017 TGTCCCCCCAGTGATGGCACTGG + Intergenic
1122892314 14:104738517-104738539 GTTTCTCCCACGGAGGGGACTGG + Intronic
1128454318 15:67823991-67824013 TTTTCCCTGAGTGAGAGGAGGGG - Exonic
1128976292 15:72156105-72156127 GTTTTCCCCAGCAAGGGGACAGG + Intergenic
1137735391 16:50719724-50719746 TTTTCCCCCAGCAAAGGGAAAGG - Intronic
1139519409 16:67471999-67472021 TCTTCACCCAGTGAGGGGTTAGG + Intronic
1140076042 16:71699669-71699691 CTTTCCACCAGTGAGGGTAAAGG - Intronic
1140917217 16:79505395-79505417 TTGTCCCTCAGTCACGGGACAGG + Intergenic
1141445914 16:84058347-84058369 TTTTCCTCCAGTGATGGTATGGG - Intronic
1141978534 16:87534661-87534683 TTTGACCCCAGTGTTGGGACTGG + Intergenic
1142234917 16:88917513-88917535 TTTTCCACCAATGAGGCGCCAGG + Intronic
1142406790 16:89894459-89894481 TTTTCCCACAGGGAGATGACGGG - Intronic
1142691057 17:1606257-1606279 GATGCCCCCAGAGAGGGGACAGG - Intronic
1144322938 17:14148179-14148201 TTTTCACCCAATGTGGTGACTGG - Intronic
1144384702 17:14738433-14738455 TGTTTCTCCAGTGACGGGACTGG - Intergenic
1144673985 17:17149967-17149989 ATTGCACCCAGTGAGGGGCCTGG + Intronic
1144863645 17:18321278-18321300 TGTTCACTCAGTGAGGGGAGCGG - Intronic
1145321380 17:21769342-21769364 TCTTCCCCCAGGGAATGGACAGG - Intergenic
1146156761 17:30530770-30530792 TGTTCACACAGTGAGTGGACAGG + Intergenic
1148259812 17:46171604-46171626 TTTTCCCCCATTGAGGGAAGTGG + Exonic
1148580599 17:48740796-48740818 TTTTCCCCCATAGAAGGGACAGG - Intergenic
1148600821 17:48892972-48892994 TTTCCCCCCAGTGCTGGGAGAGG + Intronic
1148691196 17:49528041-49528063 TTTTGGCCCAGTGAGAGGCCAGG + Intergenic
1149658509 17:58322825-58322847 TGTTCCCCCTGTGAGGGTGCTGG - Intronic
1152127469 17:78455866-78455888 ATTTGCACAAGTGAGGGGACTGG + Intronic
1153969791 18:10215773-10215795 TTCTGACCCAGTGAGGGGATGGG - Intergenic
1154437422 18:14357584-14357606 TTTTCCCCCAGGAATGGGGCGGG - Intergenic
1159351728 18:67283890-67283912 TTCTCCCACAGTGAAGGAACTGG - Intergenic
1159956770 18:74524200-74524222 GTGTCCCCCAGCGAGGGGAGGGG - Intergenic
1161382952 19:3976165-3976187 TTTTGCCCCAGAAAGGGGAAAGG - Exonic
1161422169 19:4182068-4182090 TTTTGCCCTGGCGAGGGGACTGG - Intronic
1163641746 19:18466058-18466080 TCTTCAGCCAGTGACGGGACAGG + Intronic
1165155001 19:33781556-33781578 ATTTCCCCCAGGGTGGGCACAGG - Intergenic
925043152 2:749517-749539 TTTCCCCCCAGTGCGAGGACAGG - Intergenic
925567457 2:5271677-5271699 TTTTCCTCCAGTGGGGAGCCAGG + Intergenic
925819260 2:7783531-7783553 TCTTCCCCAGGAGAGGGGACTGG + Intergenic
926680732 2:15662166-15662188 TTTTACCCCACTGAGAGGAGAGG + Intergenic
926808067 2:16730620-16730642 TTTTTCCCTAGGGAGGGGAAGGG - Intergenic
927460302 2:23292954-23292976 TCTTCCCAAAATGAGGGGACAGG + Intergenic
930416556 2:51097011-51097033 TTGTCCCACAGTGTGTGGACAGG + Intergenic
930626115 2:53699200-53699222 TGGTGCCCCAGTGATGGGACTGG - Intronic
931146647 2:59526779-59526801 ATTTCTCACAGTGTGGGGACTGG - Intergenic
935331932 2:101983468-101983490 TTTTCATCCAGTGAGGACACAGG + Intergenic
936434894 2:112495950-112495972 TTTTCCACCAGCGATGAGACAGG + Intronic
937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG + Exonic
938702963 2:133895346-133895368 TCTTCCCCTAGGGAAGGGACCGG - Intergenic
938934389 2:136116354-136116376 TTTTCGCCCAGGGAGGGAAGAGG + Intronic
940067645 2:149647827-149647849 TTTTCCCCCTTTTAGGAGACTGG - Intergenic
941933528 2:170965540-170965562 GTTTCCCCCAGTGCTGGGCCAGG + Intronic
942313960 2:174682133-174682155 TTTTCGCCCGGAGTGGGGACGGG - Intronic
943219791 2:185090353-185090375 TTTTCCTCCTGTGATGGGAGGGG - Intergenic
947615642 2:231555225-231555247 TCTCCCCCCAGTTAGAGGACAGG + Intergenic
948008088 2:234627250-234627272 AATTCTCCCAGTGTGGGGACTGG + Intergenic
1169033790 20:2433262-2433284 TTTTCCCTCAGTGAAGACACAGG + Intergenic
1174874310 20:54210367-54210389 TTTTCTCCTAGTGAGGGCAAAGG - Intronic
1176062925 20:63180065-63180087 TCCTCCCGCTGTGAGGGGACAGG + Intergenic
1176172157 20:63700943-63700965 GTGTCCCCCAGGGAGGGGATGGG - Intronic
1176380229 21:6108933-6108955 GGTTCCCCCAGTGGGGAGACGGG + Intergenic
1176839630 21:13828054-13828076 TTTTCCCCCAGGAATGGGGCAGG + Intergenic
1178586369 21:33874526-33874548 TGTTCCCCAAGTGAGTGAACAGG + Intronic
1179291534 21:40022138-40022160 TTTTCCCCTAGTGTGGTGCCTGG - Intronic
1179743245 21:43429305-43429327 GGTTCCCCCAGTGGGGAGACGGG - Intergenic
1182394606 22:30026350-30026372 TTATCCATCTGTGAGGGGACTGG - Exonic
1183032531 22:35116652-35116674 GTGTCCCCAAGTGAGGGCACTGG - Intergenic
1183219572 22:36504032-36504054 TGTTCCCCTAGGGAGGGGTCAGG + Intronic
1183958375 22:41396150-41396172 TTCCCCACCAGTGAGGAGACTGG - Exonic
1184294445 22:43514995-43515017 TCTTCCCCCGGTGATGGGTCCGG + Intergenic
1185103205 22:48852729-48852751 TTCTGCCCCAGGCAGGGGACAGG - Intergenic
949388182 3:3528996-3529018 TCTTCCCACAGTGAGGACACTGG - Intergenic
949708214 3:6843004-6843026 TTCTCCACCAGTGAGGGCAGAGG - Intronic
950112513 3:10428543-10428565 TGTTGGCCCAGTGAGGGGAGGGG - Intronic
950113409 3:10434983-10435005 TCTTCCCCCATAGAGGGCACAGG - Intronic
954372053 3:50174168-50174190 ACTGCCCCCAGTGAGGGGGCAGG + Intronic
957294754 3:78322912-78322934 TTTTCAGCCAGGGAGGGGAGAGG + Intergenic
958674665 3:97252505-97252527 ATTTTCCCCAGTGAGGGATCTGG - Intronic
960559110 3:119062935-119062957 TTTTCTCATAGTGAGGGGAGGGG - Intronic
960987806 3:123291992-123292014 TTTTCCCCCAGTTTGGGTCCTGG + Intronic
961243770 3:125434314-125434336 TTTTCCAGGAGTGAGGGGTCAGG + Intergenic
962502324 3:136008229-136008251 TTTTCCCTCAGTGACATGACTGG - Intronic
962692973 3:137919282-137919304 TTTTCTCCCACAGATGGGACTGG + Intergenic
966661862 3:182423705-182423727 TTGTACCCCAGTGTGAGGACTGG - Intergenic
968437517 4:601815-601837 GTTTCCCCCTGTTTGGGGACTGG + Intergenic
970870527 4:20812016-20812038 TTTTCCCCCACTGGGGTGTCTGG + Intronic
974018904 4:56675807-56675829 TGTTCCCCAAGTGAGTGGGCAGG + Intronic
977364983 4:96056488-96056510 TCTTCCACCAGCGAGGGGAAAGG - Intergenic
984090891 4:175374315-175374337 TTCTTCCCCAGTGATGGGAAAGG + Intergenic
984702138 4:182825356-182825378 ATTTCCCCCAGTGTGGGGTTGGG + Intergenic
986115365 5:4768544-4768566 TTTTCTCCCAGTGTGGAGGCCGG - Intergenic
986179544 5:5380752-5380774 TTTTGCTGCTGTGAGGGGACGGG - Intergenic
986571505 5:9170635-9170657 TCTTTCCCCTGTGAGGGCACAGG + Intronic
989113374 5:37928541-37928563 TGTTCCCCCAGGGAGGAGAAGGG + Intergenic
992166218 5:74054552-74054574 CTGTCCCCAAATGAGGGGACTGG - Intergenic
992886734 5:81167038-81167060 TCTTCCCCGAGTGAAGAGACGGG + Intronic
993220379 5:85087982-85088004 TTTGCCCCAATTCAGGGGACTGG + Intergenic
998258896 5:140612708-140612730 TTGTCCAGCAGTGTGGGGACAGG - Intergenic
999745757 5:154590577-154590599 CTTGCCCCCAGTGTGGGGTCTGG + Intergenic
1000168737 5:158680716-158680738 TGCTCCCCCAGTGAGATGACAGG - Intergenic
1001205825 5:169762192-169762214 TTTTGCCACAGAGAAGGGACTGG - Intronic
1002054979 5:176593659-176593681 TTTTCCCCCAGTCTGGGTTCTGG + Intronic
1002946225 6:1763864-1763886 TGTGCCCCCAGTGTGGAGACAGG - Intronic
1003397195 6:5763548-5763570 TTTGCCCCCAGTGACAGGAGTGG - Intronic
1004176954 6:13348423-13348445 TTTGCAGCCAGTGAGGGGTCGGG + Intergenic
1006030552 6:31173901-31173923 TCATCTCCCAGTGAGGGGAAGGG - Intronic
1007576178 6:42926517-42926539 CCTTCCCCCAGGGAGGGGATGGG + Intergenic
1009920812 6:70058355-70058377 TGTTCACCCAGTTAGGGAACTGG + Intronic
1013466039 6:110417848-110417870 TGTGCCCCCAGAGAGGGCACGGG - Intergenic
1014774941 6:125497741-125497763 TTCTCCCACAGTGAGGAGCCTGG + Intergenic
1014961411 6:127690580-127690602 TTTTGCCACATTTAGGGGACTGG + Intergenic
1015565216 6:134563126-134563148 TTTGGCCCCTGGGAGGGGACAGG - Intergenic
1020967982 7:14896981-14897003 GTTTCCCCCAGTGAGGCAGCTGG - Intronic
1026074034 7:67149551-67149573 TTTTCCCCCAGTGTGTGGAAGGG - Intronic
1026637718 7:72098804-72098826 TTTGCCCTCAGTGGTGGGACTGG - Intronic
1026702844 7:72662628-72662650 TTTCCCCCCAGTGTGTGGAAGGG + Intronic
1028987281 7:97018309-97018331 TTTTCCACCAGTAATGGGGCTGG + Intergenic
1030130737 7:106197585-106197607 TTTGCCCAGAGTGAGGGGAAAGG + Intergenic
1034240677 7:149608499-149608521 TTTTCCCCAAGTGGGTGGATTGG - Intergenic
1034825134 7:154255451-154255473 CTTTCCCCCAGTGCTGGGAGTGG - Intronic
1035674744 8:1448766-1448788 TTTGCACGCAGTGAGGGGAACGG - Intergenic
1037516292 8:19635211-19635233 TTTTCCACCAGTGTGGGCTCAGG - Intronic
1040110862 8:43566714-43566736 TTTCCCCCAGGTGACGGGACAGG - Intergenic
1041773661 8:61499741-61499763 TTTTCCCCCAGTGAGGGGACTGG + Exonic
1042271230 8:66957563-66957585 TTTTCCCACAGTCTGGAGACTGG - Intronic
1046262479 8:111787179-111787201 TTCTACACCAGTGAGGTGACTGG + Intergenic
1047853897 8:128889131-128889153 TTTTCTCCCAGTGAGGATAGTGG - Intergenic
1049993286 9:1010276-1010298 TTTTACCACAGTGAGGGTACAGG + Intergenic
1050246357 9:3694185-3694207 TTTGCCCCCAGTGTAGGTACTGG + Intergenic
1051171391 9:14321593-14321615 TTTTCCACCACTGAGGGGAGAGG + Intronic
1055376093 9:75649252-75649274 CTTTCCACCAGTGAGGGCAAAGG + Intergenic
1058809975 9:108630213-108630235 TTTACCTCCAGTGATGGGAGAGG - Intergenic
1059195365 9:112366379-112366401 TTTTCCTCCTGTGATGGGAGGGG - Intergenic
1059981786 9:119781055-119781077 TTTTCCCCCATAGGGGGTACTGG + Intergenic
1061860751 9:133467628-133467650 TTTTCTCACAGTGAGGGCACTGG + Intronic
1187503846 X:19863063-19863085 CTAACCCCCAGGGAGGGGACAGG - Intronic
1187793144 X:22972617-22972639 TTTTCTTACAGTGAAGGGACTGG + Intergenic
1188225375 X:27591384-27591406 TTTTACCCCATTGAGGAGACTGG + Intronic
1188562067 X:31480158-31480180 TTTTTCCCCAGTGAAAGAACAGG - Intronic
1191840665 X:65511541-65511563 TTTTGCCATTGTGAGGGGACAGG + Intergenic
1195398339 X:104435179-104435201 TTTTCCCCAAGTGGGGTGAGGGG + Intergenic
1196893107 X:120309276-120309298 CTTTCCCGCAGTGTGGAGACTGG + Intronic
1201929829 Y:19330533-19330555 TTTTACAACAGTGAGAGGACAGG - Intergenic