ID: 1041777225

View in Genome Browser
Species Human (GRCh38)
Location 8:61536679-61536701
Sequence CAGAATAGCCCCAAATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041777225_1041777226 9 Left 1041777225 8:61536679-61536701 CCTGGCTATTTGGGGCTATTCTG 0: 1
1: 0
2: 4
3: 10
4: 95
Right 1041777226 8:61536711-61536733 GAATTGATTGTGTAGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041777225 Original CRISPR CAGAATAGCCCCAAATAGCC AGG (reversed) Intronic
902532436 1:17099017-17099039 CAGAATAGCCCCAAGGCGTCAGG + Intronic
911745644 1:101439068-101439090 AAGCAAACCCCCAAATAGCCAGG - Intergenic
913032117 1:114918450-114918472 CAGAATAGCCCAAGATATTCTGG - Intronic
913331648 1:117672591-117672613 CAGAATAGGCCCCCATACCCAGG - Intergenic
917468726 1:175307712-175307734 CACAATAGCCCCACATAGGAAGG - Intergenic
919895158 1:202005039-202005061 CAGAATATCCCCGAACAGGCAGG - Intronic
922585787 1:226734225-226734247 CAAAATCGCCCCAATCAGCCTGG - Intronic
1062901746 10:1151876-1151898 CAGATGAGACCCAAATAGCCAGG - Intergenic
1072715448 10:97749470-97749492 CAGAAGAGCCCCATAGAACCTGG - Exonic
1073443891 10:103569646-103569668 CAGAAGAGCCCCAGACAGTCTGG - Intronic
1074338866 10:112606318-112606340 CAGAATAGCACGCAATGGCCGGG - Intronic
1074340415 10:112623350-112623372 TAGAGTAGCCCCAAAAAGTCAGG + Intronic
1074672947 10:115815880-115815902 CATTATAGCCTCAAATTGCCAGG + Intronic
1076013327 10:127007538-127007560 AAGAATAACCCCAGATGGCCCGG - Intronic
1078756148 11:14212280-14212302 CAGAATATCCCCAAAAAGCAAGG - Intronic
1090284058 11:125483739-125483761 CAGCAAAGCCCAAAATAGGCAGG + Intronic
1091505532 12:1063798-1063820 CAGAATACCACCAAACAGCAAGG - Intronic
1092273962 12:7045212-7045234 AAGAATAGCCTAACATAGCCGGG - Intronic
1096403542 12:51326257-51326279 CAGAATAAACCCTAATCGCCTGG - Intergenic
1096749980 12:53752271-53752293 CAGAAGAGCCCCAATTAGTAGGG - Intergenic
1099072239 12:78059581-78059603 AAAAATATCCCCAAATAGGCGGG - Intronic
1100499731 12:95162225-95162247 AAGAATAGCCCCAGTTGGCCAGG + Intronic
1101734633 12:107453859-107453881 CAGAATAGTACCAAATTCCCAGG - Intronic
1105983040 13:25538294-25538316 GAAAAAAACCCCAAATAGCCAGG - Intronic
1111767280 13:92547608-92547630 TAGGATAGCCCCAGACAGCCAGG + Intronic
1112842509 13:103598634-103598656 CAGACTAGCCCCAAACTTCCTGG + Intergenic
1114561118 14:23591176-23591198 CAAAATAGCTCCAAGTAGGCCGG - Intergenic
1114723862 14:24912706-24912728 CAGAACAGCACCAGATAGCATGG - Intronic
1121431851 14:93893336-93893358 CAGAAGAGCCCCAACTTGCCTGG - Intergenic
1124183276 15:27498698-27498720 CAGCCTGGCCTCAAATAGCCTGG - Intronic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1126167306 15:45664577-45664599 CAGAACAGCCCAGAATAGCGTGG + Intronic
1129907049 15:79195780-79195802 CAAAGTTTCCCCAAATAGCCAGG - Intergenic
1132196902 15:99920426-99920448 CAGAATAGCCCAAACAATCCTGG + Intergenic
1133725739 16:8535855-8535877 CAGGATCGACCCAAAGAGCCGGG - Intergenic
1135930862 16:26735430-26735452 CAGATGAGTCCCAAATAGCTAGG - Intergenic
1137036853 16:35575314-35575336 CAGAGCAGCCCCAAAGGGCCTGG - Intergenic
1138187473 16:54987465-54987487 CAGAAGAACCCCAAAAGGCCTGG + Intergenic
1140314356 16:73880191-73880213 CAGATTTGCCCCAAAAAGCAAGG + Intergenic
1140587417 16:76309625-76309647 CCTATCAGCCCCAAATAGCCAGG - Intronic
1144723609 17:17489297-17489319 CTGAAAACCCCCAAATAGCAAGG - Intronic
1145298499 17:21613349-21613371 CAGTATAACCCCAGATAGCCAGG - Intergenic
1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG + Intergenic
1146511768 17:33455763-33455785 CTCAAAAGCCCCAGATAGCCGGG + Intronic
1147133140 17:38420422-38420444 CAGAACAGCCCCAAAGAACTTGG - Intergenic
1149787128 17:59445131-59445153 CTAAATAGCCCCAAATAGAAAGG - Intergenic
1150262010 17:63801427-63801449 CAGACTGGCCCCAAATCCCCTGG + Intronic
1150831420 17:68523306-68523328 CAGCATAACTCAAAATAGCCTGG - Intronic
1156390638 18:36647667-36647689 CAAAATAGCCCCAAATTGAAGGG + Intronic
1156678383 18:39559195-39559217 CAGGATAGCCACAAATATCTGGG + Intergenic
1157245605 18:46051672-46051694 CAGAAAAGCCCCAAACCCCCAGG + Intronic
1158398545 18:57099059-57099081 CAGAATATACCCAAAGAGTCTGG - Intergenic
1159188287 18:65007720-65007742 CAGAATAGCCCAAATTGGCCAGG - Intergenic
1161647917 19:5465742-5465764 CAGAATTGCCCCACCTGGCCAGG + Intergenic
1168644466 19:58051231-58051253 CACAATGGCCCCCAGTAGCCAGG + Intronic
932564602 2:72897974-72897996 CAGAACAGCCACAAAATGCCAGG + Intergenic
935930405 2:108118002-108118024 AAGATCAGCCCCAAATGGCCAGG - Intergenic
936653615 2:114458156-114458178 CAGAATAGCACAGGATAGCCTGG - Intronic
938403605 2:131014811-131014833 CACGACAGCACCAAATAGCCAGG + Intronic
946923939 2:224607416-224607438 CAGAGGAACCCCAAATAGCTCGG - Intergenic
1171220028 20:23387859-23387881 CAGAATAACACCAAATATCTGGG - Intronic
1174673641 20:52332227-52332249 CAAACAAGCCCCAAATAGCAGGG + Intergenic
1176649240 21:9530412-9530434 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1177168924 21:17634077-17634099 CAGAATAGCCTCACATACACTGG + Intergenic
1179880251 21:44290629-44290651 CAGAATCCCCCCAGACAGCCAGG - Intronic
1182586117 22:31345249-31345271 CAGAATGTCCCCAAATACCTTGG + Exonic
949377130 3:3403154-3403176 CAAAATAACCCCAAATAACCTGG + Intergenic
950450350 3:13061720-13061742 CAGACTTGCCCCAAACTGCCAGG + Intronic
951907095 3:27716178-27716200 CAGAATATTCCCAAATATCATGG + Intronic
953733153 3:45467049-45467071 CAGAATGGGCACAAATGGCCAGG + Intronic
953852783 3:46478753-46478775 CAGAATATTTCCAAATATCCTGG - Intronic
956414963 3:69015770-69015792 TAAAATAGCACCACATAGCCAGG - Intergenic
957024684 3:75167936-75167958 CACTATAGCCCCAAATAGCTGGG - Intergenic
962168603 3:133077165-133077187 CAGCACAGCCCCAAACGGCCAGG - Intronic
962715784 3:138124894-138124916 CAAATCAGCCCCAAGTAGCCAGG + Intronic
967369423 3:188727107-188727129 CAGAAAAGCCCAAAGTAGCTTGG + Intronic
968057742 3:195705595-195705617 CAGTTTAGCCCTAAAGAGCCAGG + Intergenic
973920647 4:55681608-55681630 CAGGATGGCCCCAATGAGCCCGG + Intergenic
973959447 4:56095274-56095296 CAGAAGAGCCCCAACCACCCGGG - Intergenic
976886505 4:89991268-89991290 GAGAAAAGCCCCAAATAGCATGG - Intergenic
977581417 4:98729100-98729122 CAGATAAGCCACATATAGCCAGG + Intergenic
979482557 4:121236643-121236665 CAGGCTACCCCCAAATAGGCAGG - Intergenic
989764122 5:45059195-45059217 CAGAATATCCCAAAAGAGCTGGG - Intergenic
990020986 5:51127542-51127564 AAGAATACCCCAAAATGGCCAGG + Intergenic
993221578 5:85105001-85105023 TTGAATAGCCCCAAATAGTAAGG + Intergenic
999229556 5:150053672-150053694 CTGTCTAGCCCCAAAGAGCCTGG + Exonic
1000996863 5:167968212-167968234 CAGAATGGCCCCAAATTGTCTGG - Intronic
1006190428 6:32204247-32204269 CAGCGTAGCCCCACAAAGCCTGG + Exonic
1013267981 6:108518946-108518968 CAGACCAGCTCCAAACAGCCAGG + Intronic
1017404540 6:154104141-154104163 CACAAGAGCCCCTAATAGCTAGG - Intronic
1019306993 7:340328-340350 CAGGACAGCCCCAAAGTGCCAGG - Intergenic
1025275778 7:57580467-57580489 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1027196777 7:76036061-76036083 CAGAATAGCACCAAATGGGATGG - Intronic
1027512998 7:79107117-79107139 GAGATTAGCCTCAAATATCCAGG + Intronic
1033555897 7:142488418-142488440 CAGAGTGGCCCCAAGTGGCCCGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG + Exonic
1043621196 8:82194392-82194414 CAGAATATTCCCAAATATTCTGG - Intergenic
1051488303 9:17632800-17632822 CAGGGAAGCCCCAAATAGCAGGG - Intronic
1054782558 9:69178571-69178593 CAGAATGGCCCAGAATAGCCAGG + Intronic
1057789604 9:98115677-98115699 AAGAATACTCACAAATAGCCAGG - Intronic
1058831185 9:108818328-108818350 CAAAATAGCCACACATGGCCAGG + Intergenic
1059209050 9:112494581-112494603 CAGTTTAGCCCCAAGTAGCTGGG + Intronic
1060736825 9:126071389-126071411 GAGAAGAGCCCCAAAAACCCAGG - Intergenic
1061356489 9:130109465-130109487 AAGAATATCCCCAAAGAGGCTGG - Intronic
1203626979 Un_KI270750v1:33960-33982 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1194217217 X:91145710-91145732 CAGAATATCCAGAAACAGCCCGG - Intergenic
1195155143 X:102115609-102115631 CAGGAAAGCCCCAAATGGCAGGG + Intergenic
1198315905 X:135465916-135465938 CAGAATAGCCAAAATTATCCTGG + Intergenic
1199340169 X:146668287-146668309 CAGGTTAGCACCAAATATCCTGG + Intergenic