ID: 1041777226

View in Genome Browser
Species Human (GRCh38)
Location 8:61536711-61536733
Sequence GAATTGATTGTGTAGCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041777220_1041777226 29 Left 1041777220 8:61536659-61536681 CCTTCAGTTATTAATCAAATCCT 0: 1
1: 1
2: 7
3: 29
4: 233
Right 1041777226 8:61536711-61536733 GAATTGATTGTGTAGCTCCCTGG No data
1041777225_1041777226 9 Left 1041777225 8:61536679-61536701 CCTGGCTATTTGGGGCTATTCTG 0: 1
1: 0
2: 4
3: 10
4: 95
Right 1041777226 8:61536711-61536733 GAATTGATTGTGTAGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041777226 Original CRISPR GAATTGATTGTGTAGCTCCC TGG Intronic
No off target data available for this crispr