ID: 1041777243

View in Genome Browser
Species Human (GRCh38)
Location 8:61536830-61536852
Sequence GGGCAGGTTACTGCAGGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041777234_1041777243 14 Left 1041777234 8:61536793-61536815 CCTGGGCTGTTTATCATAGATAA 0: 1
1: 0
2: 9
3: 26
4: 160
Right 1041777243 8:61536830-61536852 GGGCAGGTTACTGCAGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041777243 Original CRISPR GGGCAGGTTACTGCAGGTTG TGG Intronic
No off target data available for this crispr