ID: 1041779656

View in Genome Browser
Species Human (GRCh38)
Location 8:61563811-61563833
Sequence TATTATCCACAACAAAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041779646_1041779656 27 Left 1041779646 8:61563761-61563783 CCTTCCCCCTATCTGCCCACCTA 0: 1
1: 0
2: 1
3: 62
4: 650
Right 1041779656 8:61563811-61563833 TATTATCCACAACAAAAGCATGG No data
1041779650_1041779656 21 Left 1041779650 8:61563767-61563789 CCCTATCTGCCCACCTAGGCTCA 0: 1
1: 0
2: 0
3: 8
4: 178
Right 1041779656 8:61563811-61563833 TATTATCCACAACAAAAGCATGG No data
1041779654_1041779656 8 Left 1041779654 8:61563780-61563802 CCTAGGCTCACACTTTCTTCTAG 0: 1
1: 0
2: 1
3: 16
4: 285
Right 1041779656 8:61563811-61563833 TATTATCCACAACAAAAGCATGG No data
1041779648_1041779656 23 Left 1041779648 8:61563765-61563787 CCCCCTATCTGCCCACCTAGGCT 0: 1
1: 0
2: 0
3: 28
4: 278
Right 1041779656 8:61563811-61563833 TATTATCCACAACAAAAGCATGG No data
1041779652_1041779656 12 Left 1041779652 8:61563776-61563798 CCCACCTAGGCTCACACTTTCTT 0: 1
1: 0
2: 0
3: 20
4: 168
Right 1041779656 8:61563811-61563833 TATTATCCACAACAAAAGCATGG No data
1041779653_1041779656 11 Left 1041779653 8:61563777-61563799 CCACCTAGGCTCACACTTTCTTC 0: 1
1: 0
2: 2
3: 49
4: 718
Right 1041779656 8:61563811-61563833 TATTATCCACAACAAAAGCATGG No data
1041779651_1041779656 20 Left 1041779651 8:61563768-61563790 CCTATCTGCCCACCTAGGCTCAC 0: 1
1: 0
2: 0
3: 18
4: 210
Right 1041779656 8:61563811-61563833 TATTATCCACAACAAAAGCATGG No data
1041779649_1041779656 22 Left 1041779649 8:61563766-61563788 CCCCTATCTGCCCACCTAGGCTC 0: 1
1: 0
2: 1
3: 12
4: 170
Right 1041779656 8:61563811-61563833 TATTATCCACAACAAAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041779656 Original CRISPR TATTATCCACAACAAAAGCA TGG Intronic
No off target data available for this crispr