ID: 1041782033

View in Genome Browser
Species Human (GRCh38)
Location 8:61587315-61587337
Sequence TGACACAGATTGATGGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041782031_1041782033 17 Left 1041782031 8:61587275-61587297 CCATATATGCTGATATGGAAAAT 0: 1
1: 0
2: 1
3: 30
4: 286
Right 1041782033 8:61587315-61587337 TGACACAGATTGATGGTAGTAGG No data
1041782029_1041782033 30 Left 1041782029 8:61587262-61587284 CCATTATATGTTACCATATATGC 0: 1
1: 0
2: 0
3: 23
4: 235
Right 1041782033 8:61587315-61587337 TGACACAGATTGATGGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041782033 Original CRISPR TGACACAGATTGATGGTAGT AGG Intronic
No off target data available for this crispr