ID: 1041784859

View in Genome Browser
Species Human (GRCh38)
Location 8:61620731-61620753
Sequence GAGGGTTGCAGTGTTCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041784859_1041784863 2 Left 1041784859 8:61620731-61620753 CCTGCAGGAACACTGCAACCCTC 0: 1
1: 0
2: 1
3: 18
4: 175
Right 1041784863 8:61620756-61620778 CATCCCCCAGTCATTGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041784859 Original CRISPR GAGGGTTGCAGTGTTCCTGC AGG (reversed) Intronic
900965344 1:5953511-5953533 GTGGCTGGCCGTGTTCCTGCTGG - Intronic
901532208 1:9860715-9860737 GAGGATTTCAGTGGTCTTGCAGG - Intronic
902192886 1:14775956-14775978 GAGGGTCGCAGTGATCACGCAGG - Intronic
902615807 1:17622989-17623011 GGGGGTTGCGGTAGTCCTGCCGG - Exonic
903178182 1:21592786-21592808 GCGGGATGCAGTGTTCCTAAGGG - Intergenic
904454404 1:30638736-30638758 GAGGGAGGCAGTGTGGCTGCTGG - Intergenic
904710638 1:32427231-32427253 GAGGGGAGGAGTGTTCCTGCGGG - Intergenic
905945573 1:41898714-41898736 GAAGGTAGCAGTGTCTCTGCAGG + Intronic
906274518 1:44506245-44506267 GAGGGTGGCAGGGTTGCTGGTGG + Intronic
906525115 1:46489342-46489364 GGGGGTGGCAGTGTTGTTGCAGG + Intergenic
912458961 1:109818608-109818630 GAGGGAGGCAGTGTCCCTGCTGG + Intergenic
913433764 1:118825927-118825949 GAGGGTTGCAGCTTTGCTGTGGG + Intergenic
914335911 1:146714829-146714851 TAGGGTAGAAGTGTTCCAGCAGG - Intergenic
917572066 1:176277658-176277680 GGGGGTTGTAGAGTTCCTGATGG + Intergenic
919135737 1:193506109-193506131 GAGGGTTGCTGTATCTCTGCTGG - Intergenic
919787404 1:201268590-201268612 GAGTGGTGCAGGGTCCCTGCAGG - Intergenic
921213506 1:212919004-212919026 GAGGGTTGCAGTCCTACTGTAGG + Intergenic
922749279 1:228063138-228063160 GAGGGCTGAAGTGTGGCTGCTGG + Intergenic
924458643 1:244238609-244238631 GAGGGTAGCCGTGTACCTGTGGG + Intergenic
1066209094 10:33218964-33218986 GAGGACTACAGTATTCCTGCTGG - Intronic
1067052495 10:43030080-43030102 GAGGGTTGCAAGTTTCCTTCAGG - Intergenic
1067877944 10:50020834-50020856 CAGGGTTCCAGGGTTCCTGAGGG - Intergenic
1069658251 10:70106193-70106215 GAGGGTGGCAGTGCTGCTGCTGG - Intronic
1070658070 10:78284757-78284779 GAGGGCTGCAGTGTAGTTGCAGG + Intergenic
1070914654 10:80145094-80145116 GGGGGTTGCAGGCTTCCTCCAGG - Exonic
1072058216 10:91781960-91781982 CAGGCTGGCAGTGTTTCTGCTGG + Intergenic
1072524207 10:96257247-96257269 GGGGGTTACAGGCTTCCTGCTGG + Intronic
1072925220 10:99611178-99611200 GGGGGTTAAAGTGCTCCTGCAGG + Exonic
1074171514 10:110943665-110943687 CAAGGTTTCAGTGTTCCAGCAGG - Intronic
1074548127 10:114417786-114417808 GATCGCTTCAGTGTTCCTGCTGG + Intergenic
1081858872 11:46320655-46320677 GAGGGTAAGAGGGTTCCTGCTGG + Intronic
1081921772 11:46785064-46785086 GAGGGTTGTAGTGTTTTTGTAGG - Intronic
1083419840 11:62546572-62546594 GTGGGTTGCGGTGCTCCGGCAGG - Intronic
1084558980 11:69892156-69892178 GAGGGTCGCGGTGTCCGTGCAGG + Intergenic
1085522737 11:77147791-77147813 GAGAGATCCAGTGTTCCTGCGGG - Exonic
1085980121 11:81714651-81714673 GAAGCTGGTAGTGTTCCTGCAGG + Intergenic
1087007842 11:93486612-93486634 GAGAGTTGCACTTTTCCTGGGGG - Intronic
1088648537 11:111937488-111937510 CAGGCTAGCATTGTTCCTGCTGG - Intronic
1089018728 11:115189101-115189123 TATGACTGCAGTGTTCCTGCAGG + Intronic
1089807762 11:121106683-121106705 TAGGGTTGCATTCTTCCTCCAGG - Intronic
1090868636 11:130723744-130723766 GAGGGTTTCAGTATTCTTGCAGG + Intergenic
1092336406 12:7638143-7638165 GAGGGTGGCACTCTTCCTGTTGG - Intergenic
1097171563 12:57117210-57117232 GATGGTTTCAGTGCTCCGGCAGG - Intronic
1098543924 12:71689992-71690014 GAGTGCTCCAGTGTTTCTGCTGG - Intronic
1100603631 12:96133221-96133243 GATGGTTGAATTGTTCCTGAGGG + Intergenic
1101427788 12:104601964-104601986 TTGGGTTGTAGAGTTCCTGCAGG - Exonic
1102131258 12:110530560-110530582 GGTGGTTGAAGTGTTCTTGCTGG - Exonic
1107350567 13:39510060-39510082 GTGGGATTCAGTCTTCCTGCAGG - Intronic
1113226923 13:108169208-108169230 GGGAGTTGCAGAGCTCCTGCTGG - Intergenic
1113924854 13:113935705-113935727 TAGGGTGGGAGTTTTCCTGCCGG + Intergenic
1114532322 14:23403685-23403707 GAGGGTGGCAGCCTCCCTGCTGG + Intronic
1114549273 14:23523859-23523881 GAGGCTTGCAGTCTCTCTGCAGG - Exonic
1118843602 14:69529626-69529648 CAGGGAGGCAGTGTTCCTGCTGG + Exonic
1124377403 15:29136948-29136970 GGGAGTTGCAGTGGTCCTGCAGG - Intronic
1129699620 15:77760176-77760198 GAAGGTAGCAGGGTGCCTGCCGG + Intronic
1129768116 15:78182912-78182934 AAGGGTGGCAGTTGTCCTGCTGG - Intronic
1130905936 15:88240957-88240979 GAGGGTTGCTGTGGGCCTGGGGG + Intronic
1131515786 15:93075713-93075735 GGGAGTTCCAGTGTCCCTGCCGG + Intronic
1135921762 16:26656597-26656619 TAGGATTGCTGTGTTCCTGCTGG + Intergenic
1138789099 16:59881392-59881414 GAGGGTAGCTGTGTTCTTTCAGG - Intergenic
1139081305 16:63524966-63524988 GAGGGGTGCCTTGTTACTGCTGG - Intergenic
1140257435 16:73349291-73349313 CAGGGTTGCAGTGTGACTCCAGG - Intergenic
1140805242 16:78526802-78526824 GAGGGTGGCAGTGATCTTGAGGG + Intronic
1141739200 16:85879359-85879381 GAGGGTTCCTGTTTCCCTGCTGG + Intergenic
1143685788 17:8514601-8514623 GAGGGTTTCTGTGTTCCTGAAGG - Intronic
1152943773 17:83187073-83187095 GGGGGTCCCAGGGTTCCTGCAGG - Intergenic
1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG + Intergenic
1160393463 18:78555391-78555413 GTGGGGTGCGATGTTCCTGCTGG - Intergenic
1160582824 18:79896916-79896938 ATGGCTTGCAGTGTTTCTGCTGG + Intronic
1160585494 18:79911398-79911420 GAGGGCTCCAGAGTTCCAGCCGG + Intronic
1160857438 19:1223861-1223883 GAGTTTTGCAGTGTATCTGCAGG + Intronic
1161383858 19:3980756-3980778 GTGGGTTGCAGGGTTCCAGAAGG - Intronic
1163596225 19:18222470-18222492 GAGGGGTGCAGGGTTCCTGAGGG - Intronic
1164411588 19:28010568-28010590 CAGAGTTGCAGTGTTCCTCATGG - Intergenic
1165425430 19:35742844-35742866 GAGTGGTGCAGAGATCCTGCAGG + Intronic
1165884883 19:39070947-39070969 GAGGGCTGGGGTGTTCCTGGAGG + Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1168580883 19:57554827-57554849 GAGGGTAACAGTGTTCCAGGTGG - Intronic
925046023 2:773705-773727 GAGGGTCACAGGGTGCCTGCTGG - Intergenic
925148214 2:1595074-1595096 GAGGCTGGCAGTGTTCCCGGAGG + Intergenic
925174894 2:1775827-1775849 GAGGGGTGCTGGGTTCCTGTTGG - Intergenic
926795301 2:16614278-16614300 GTGGATTGCAGATTTCCTGCAGG - Intronic
927845095 2:26467294-26467316 GGGGGGCGCAGTGATCCTGCAGG - Intronic
932579571 2:72984690-72984712 GAGGTTTGCAGAGCTCCTGGGGG - Intronic
936755764 2:115709788-115709810 GAGATTTGCAGTTTTCCTACAGG - Intronic
937097778 2:119247090-119247112 GAGGACTGCAATGTGCCTGCAGG + Intronic
937668858 2:124517540-124517562 GAGGGTTGTAGTGTTGGTGATGG + Intronic
937668878 2:124517650-124517672 GAGGGTTGTAGTGTTGGTGATGG + Intronic
937668920 2:124517866-124517888 GAGGGTTGTAGTGTTGGTGATGG + Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942113658 2:172706917-172706939 GAGGGTCTCCTTGTTCCTGCTGG + Intergenic
943312090 2:186338528-186338550 GAGGTTTGCAGCATTACTGCTGG + Intergenic
946761769 2:223001507-223001529 GAGGGATGCTGTGTTCCTTCAGG - Intergenic
948660315 2:239502756-239502778 AAGGGTGGCAGTGCTTCTGCAGG - Intergenic
1170699112 20:18687293-18687315 GAGGGTGGCAGTGTTGGTGGAGG + Intronic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1172854285 20:37989568-37989590 TAGGCTTGCAGGGTTCCTGGAGG - Intronic
1172917534 20:38454145-38454167 GAGCCCTGCAGTGTTTCTGCTGG + Intergenic
1173228057 20:41173566-41173588 GAGGCTTGCAGTGCCCCAGCAGG - Intronic
1173277937 20:41600833-41600855 CAGAGTTGCAGTGTGCCTACAGG + Intronic
1174367535 20:50065549-50065571 GAGGGTTGGAGTCCTCCTCCTGG + Intergenic
1176789785 21:13306844-13306866 AAGGGTTGCAGCCTTCCTGGTGG - Intergenic
1178716057 21:34965577-34965599 GATGTTTGGAGTGTTCATGCAGG + Intronic
1182517912 22:30869423-30869445 GAGAATGGCTGTGTTCCTGCAGG + Intronic
1184601948 22:45548991-45549013 GAGGGCTGAAGTGTTCCTGCCGG - Intronic
950592522 3:13948500-13948522 GAAGGAAGCAGTGCTCCTGCAGG - Intronic
950887335 3:16373543-16373565 GAAGGCTGCAGTTTGCCTGCAGG + Intronic
952751957 3:36831833-36831855 GAGGCTTGCAGTATGGCTGCAGG + Exonic
952899836 3:38102872-38102894 GAGAGGTCCAGTGTTACTGCAGG + Intronic
953040266 3:39250051-39250073 AAGGGTAGCAGTGTCCCTGCTGG + Intergenic
953850784 3:46464273-46464295 GAGGGGTGCGGTGCTCCTGATGG - Intronic
954051024 3:47977734-47977756 GAGGGTGGTAGTGTTCTTGTTGG - Intronic
954394568 3:50286670-50286692 TAGGGGCGCAGTGTGCCTGCTGG - Exonic
954428518 3:50456606-50456628 GAGGGCAGCAGGGTTCCTGGTGG - Intronic
961635554 3:128330615-128330637 CAGGGCAGCAGTGTTCCTGTGGG + Intronic
962422513 3:135240874-135240896 GTGGGTTCCAATGTTGCTGCAGG - Intronic
964858839 3:161177933-161177955 GATGGATGCAGTGTTAGTGCTGG - Intronic
966218842 3:177530668-177530690 GAAGGTAACAGTGTTACTGCTGG + Intergenic
968548633 4:1211172-1211194 GAGGGAAGCAGTGTGCCAGCCGG - Intergenic
969989771 4:11250114-11250136 GAGGGAGCCAGTGTGCCTGCTGG - Intergenic
970433077 4:16006906-16006928 TAGGTTTGCATTGTTCCTGGTGG + Intronic
971322139 4:25614215-25614237 CATGGTTGCAGTATCCCTGCTGG - Intergenic
971551445 4:27962680-27962702 GAGGGATGCAGTGTTTGAGCAGG - Intergenic
974890267 4:67873309-67873331 AAGGCTTTCAGTGTTTCTGCAGG + Intronic
979815762 4:125101602-125101624 CAGGTTGGCAGTGTTTCTGCTGG - Intergenic
982209433 4:153022583-153022605 GAGGGTAGCAGGGTGCCTCCTGG + Intergenic
982231073 4:153208774-153208796 GATGGATGCAGTGTTCCATCTGG - Intronic
985794088 5:1949334-1949356 GAGGGCTGCAGCATCCCTGCGGG + Intergenic
986261088 5:6147032-6147054 GAGGCTTACAGTGCTACTGCTGG + Intergenic
986270634 5:6227776-6227798 GAGGCTGGCACTGTTACTGCAGG - Intergenic
988619217 5:32805259-32805281 GATGGCTGCAGTGGTACTGCTGG + Intergenic
988994801 5:36704532-36704554 CAGGGTAGAAGTGATCCTGCTGG - Intergenic
993041993 5:82824870-82824892 GATGGCTGCTGTGTTCCTGCTGG - Intergenic
996277514 5:121685191-121685213 GGGGGTTGCAGAGTTGCTGGAGG - Intergenic
997523536 5:134538372-134538394 GAGAGTTGCAGTCATCCAGCAGG + Intronic
1000096610 5:157976766-157976788 GAGGGTTGCATCATTCCTGGAGG + Intergenic
1002650179 5:180685749-180685771 CAGTGTTGCTGTGTTCCTTCTGG + Intergenic
1007632430 6:43280076-43280098 CAGGGTTGCTGGGGTCCTGCTGG + Intronic
1009888667 6:69655264-69655286 GAGGGTTGCAAAGTTCCATCAGG - Intergenic
1013579390 6:111518163-111518185 GAGGGTGGGAGTGATGCTGCAGG - Intergenic
1015364724 6:132384964-132384986 GAGCCTGGCAGTGGTCCTGCAGG + Intronic
1016671966 6:146719708-146719730 GAGGGGTGGGGTGTTCCTGAAGG - Intronic
1017555462 6:155561399-155561421 CAGGGTTGCAGTGTTCCTATTGG + Intergenic
1017960033 6:159213500-159213522 GGGGGTCACAGTGTCCCTGCTGG - Intronic
1019174571 6:170153687-170153709 GAAGGTTGCTGTGGTCCTGGCGG - Intergenic
1021662325 7:22932247-22932269 CAGGCTGGCAGTGTTCCTACTGG - Intergenic
1022451867 7:30523369-30523391 GAGAGGTGCAGTGACCCTGCAGG - Intronic
1022823703 7:33987224-33987246 GAGGGTGGCAGTGCTCCTGTGGG + Intronic
1023282879 7:38590034-38590056 GAGTGTTGAAGTGTTACTGGGGG + Intronic
1023857699 7:44194789-44194811 GTGGGGAGCAGTGTTCCTGAGGG + Intronic
1024005933 7:45224864-45224886 CAGGATTGCAGTGCTCCTGGGGG - Intergenic
1024009840 7:45258332-45258354 GGGGGTTGCTGGGCTCCTGCAGG + Intergenic
1024535862 7:50432082-50432104 GGGGGTTGCATTGTTCCACCAGG + Intergenic
1024966445 7:55026358-55026380 GAGGGGTGGAGTGTTCTTTCTGG - Intronic
1027266582 7:76498150-76498172 GAGGGTGGCCGTGGCCCTGCTGG + Intronic
1027317963 7:76996268-76996290 GAGGGTGGCCGTGGCCCTGCTGG + Intergenic
1031529147 7:122855156-122855178 GAGGGTTGCTATTTTCCTGGAGG + Intronic
1031865644 7:127036346-127036368 AAGGGTTGCAGTTTTCTTGCAGG - Intronic
1034013493 7:147556555-147556577 GAGAGTTGCAGTGATGCAGCAGG + Intronic
1035426948 7:158784347-158784369 GAGGGTTGCAGTGTTTGAACAGG - Intronic
1036206435 8:6808973-6808995 AAGGGTTGCAGTCCTCCTTCTGG - Exonic
1040023586 8:42761960-42761982 GAGGGATCCAGTGTTTGTGCTGG - Intronic
1041784859 8:61620731-61620753 GAGGGTTGCAGTGTTCCTGCAGG - Intronic
1042223514 8:66496592-66496614 GAGGGTTTCAGTGTTCCATGTGG + Intronic
1047442007 8:124886839-124886861 AAGGGTTGACATGTTCCTGCCGG - Intergenic
1049208440 8:141374299-141374321 AAGGGATGCAGTGGTCCTGGGGG + Intergenic
1049581493 8:143413205-143413227 GAGGGTGGCAGTGGTCTTGTCGG - Intergenic
1049754921 8:144306657-144306679 GAGAGTTCCAGTTTTCCAGCCGG - Intronic
1050314262 9:4385160-4385182 ATGGGTTGCAGTGTGCCTGCAGG + Intergenic
1055386971 9:75772690-75772712 GAGGGTGACAGTGATCCAGCTGG - Intergenic
1056167865 9:83956392-83956414 GAGGGTGGCAGAGCTGCTGCTGG - Exonic
1057219070 9:93246065-93246087 GAGGGGTGAAGTGTCACTGCTGG - Intronic
1058427315 9:104886182-104886204 GATGGAAGGAGTGTTCCTGCTGG - Intronic
1058899690 9:109431179-109431201 GGGGGTTGGAGAGTCCCTGCAGG + Intronic
1058901514 9:109446434-109446456 AAGTGATGCTGTGTTCCTGCTGG + Intronic
1062402236 9:136377787-136377809 GAGGCTTGCAGTGCTCCGGCCGG + Exonic
1062506950 9:136882445-136882467 GAGGGTGCCAGTGTCCCTGGAGG - Intronic
1186021774 X:5264397-5264419 GAGGGGGGCACTGTGCCTGCAGG + Intergenic
1186854040 X:13608978-13609000 GAGAGTTCCATTGTTCTTGCTGG + Intronic
1187392065 X:18892554-18892576 GAGGGAAGCATTGTTTCTGCGGG + Exonic
1190406375 X:50091777-50091799 GAGGAGGGCAGAGTTCCTGCTGG + Intronic
1196892863 X:120307857-120307879 GAGGGCTGCAGTAGTTCTGCAGG - Intronic
1198745261 X:139883302-139883324 GAGGGTTCCAGTGTCCAAGCAGG - Intronic
1200703281 Y:6420380-6420402 GAGGGTTACAGGATTCCTGTAGG - Intergenic
1200703517 Y:6422185-6422207 GAGGGCTGCAGGGTTCGTGAAGG - Intergenic
1200835103 Y:7725287-7725309 GAAGGCTGCAGTTTGCCTGCAGG + Intergenic
1200918494 Y:8592340-8592362 GAGGGCTGCATGATTCCTGCAGG + Intergenic
1200934367 Y:8725341-8725363 GAGGGCTGCAGAATTCCTGTAGG - Intergenic
1200963640 Y:9017035-9017057 GAGGGCTGCATGATTCCTGCAGG - Intergenic
1201030594 Y:9742522-9742544 GAGGGCTGCAGGGTTCGTGAAGG + Intergenic
1201030829 Y:9744327-9744349 GAGGGTTACAGGATTCCTGTAGG + Intergenic