ID: 1041788635

View in Genome Browser
Species Human (GRCh38)
Location 8:61664809-61664831
Sequence ACAGGGAAGCAGGAAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2002
Summary {0: 1, 1: 0, 2: 26, 3: 219, 4: 1756}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041788630_1041788635 -8 Left 1041788630 8:61664794-61664816 CCACGAAAGAGAAAAACAGGGAA 0: 1
1: 0
2: 6
3: 49
4: 753
Right 1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG 0: 1
1: 0
2: 26
3: 219
4: 1756
1041788627_1041788635 5 Left 1041788627 8:61664781-61664803 CCTGGGGAGGTGTCCACGAAAGA 0: 1
1: 0
2: 0
3: 13
4: 87
Right 1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG 0: 1
1: 0
2: 26
3: 219
4: 1756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041788635 Original CRISPR ACAGGGAAGCAGGAAGGGGA AGG Intronic
Too many off-targets to display for this crispr