ID: 1041790590

View in Genome Browser
Species Human (GRCh38)
Location 8:61692581-61692603
Sequence TCACCTGGAAGGTTTTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041790590 Original CRISPR TCACCTGGAAGGTTTTTGGA GGG (reversed) Intronic
900671131 1:3855693-3855715 ACAACTGGAAGGTCTTTGGGAGG - Intronic
900763249 1:4486915-4486937 TCACCTGGGAGGCTCCTGGAAGG + Intergenic
902628486 1:17690502-17690524 TGACCTGGAGGGTCTTAGGAGGG - Intronic
905261014 1:36719300-36719322 TAACCTGTAAGGTTGTTGCAAGG + Intergenic
905269497 1:36777854-36777876 TCAGCTGGAAGTTGTTTTGATGG - Intergenic
905443592 1:38009982-38010004 TCACAAGGAAAGTTTCTGGACGG - Intronic
907405203 1:54249820-54249842 TGACCTGGAGGGCTGTTGGAAGG - Intronic
911114710 1:94235603-94235625 TCACTTGGAAGCTTTTTAGTAGG - Intronic
911115236 1:94239250-94239272 TCATAAGTAAGGTTTTTGGAAGG + Intronic
912418758 1:109529573-109529595 CCACATTGAGGGTTTTTGGAGGG - Intergenic
914694927 1:150068226-150068248 GCACTTGGAAGGCTTTGGGATGG + Intronic
915462921 1:156080735-156080757 TCACCTGGAAATTTGGTGGAGGG - Intronic
916338837 1:163705408-163705430 TCACCTGCAAGATTTTTGCATGG + Intergenic
917453587 1:175167274-175167296 TCACCTGAAAAGGTCTTGGAGGG - Intronic
917488812 1:175479789-175479811 GCAGCTGGGAGGTTTTTCGAAGG - Intronic
917677381 1:177332770-177332792 TCACCTTGGGGGTCTTTGGAGGG + Intergenic
919905697 1:202076879-202076901 TCTCCAGGAAGGTTTTGGCATGG - Intergenic
920248803 1:204608396-204608418 TCACCTGGGAGCTTTTTAAAAGG + Intergenic
920676257 1:208040509-208040531 TAACCTTGAGTGTTTTTGGAGGG - Intronic
923949139 1:238927298-238927320 TCATCTTGAAGGTTTTAAGAAGG - Intergenic
924352612 1:243132299-243132321 TCACCTAGGAGGTTTAGGGAAGG - Intronic
1063648781 10:7912878-7912900 TCACCTGTTAGGTTTTTTGTCGG + Intronic
1063951305 10:11225860-11225882 TCACCTGAAATATTTTTAGAAGG - Intronic
1064863109 10:19848797-19848819 TTGCCTGTAAGGGTTTTGGAAGG + Intronic
1067935661 10:50610338-50610360 TCACCAGGAAGGTATTTAAAAGG - Intronic
1069124759 10:64616733-64616755 TGACCAGGTATGTTTTTGGATGG + Intergenic
1070399022 10:76036555-76036577 TCTCCTGGGAGGTTTCTGGAAGG + Intronic
1072016290 10:91349962-91349984 CCATCTGGAAGGTTGTGGGAGGG - Intergenic
1073538593 10:104299962-104299984 TCACCAGGGAGGTCTTTGGAGGG - Intronic
1075268429 10:121026296-121026318 TCATTTAGAAGGGTTTTGGAGGG + Intergenic
1075671759 10:124267952-124267974 TCTTCTGGAAGGGGTTTGGAAGG - Intergenic
1076183385 10:128427985-128428007 GGACCTGGAGTGTTTTTGGATGG - Intergenic
1076732197 10:132444502-132444524 TCACCTGGAGGCTTTCTGCAGGG - Intronic
1079477713 11:20848693-20848715 TCCTCTTGATGGTTTTTGGAAGG - Intronic
1081737303 11:45412909-45412931 CCACCTGGAAGGTGTTGGGAGGG - Intergenic
1082218764 11:49606572-49606594 TCTCTTGAAAGGTTGTTGGAAGG + Intergenic
1086630807 11:89017550-89017572 TCTCTTGAAAGGTTGTTGGAAGG - Intronic
1086749146 11:90468572-90468594 TCATCTGGAAGGTTCTCAGAAGG + Intergenic
1087648236 11:100832886-100832908 TGACATGGAAGGATTTTGAATGG + Intronic
1088475873 11:110238951-110238973 ACACTTGGAAGGTTTTGAGAGGG + Intronic
1088971694 11:114779855-114779877 TCACCTCGAGGGAATTTGGAGGG - Intergenic
1096466903 12:51851693-51851715 TCAGCTCAAAGGATTTTGGAGGG + Intergenic
1098567786 12:71955298-71955320 TCTCCTGGGAGGTTTTTTTAAGG + Intronic
1099096949 12:78386195-78386217 TCTTCTGGAAGGTTGTTTGATGG + Intergenic
1101225206 12:102681414-102681436 TCACAGGGAAGGTTGTTAGATGG + Intergenic
1101330539 12:103754266-103754288 TTACCTGGAATGTTTGTGGAAGG + Intronic
1101424495 12:104576729-104576751 TCACCTGGAATGTGTTTAAAAGG + Intronic
1101441966 12:104710492-104710514 TCCCCTGGAAGGGTATAGGATGG - Intronic
1103031632 12:117619072-117619094 TCTCCTAGAAGGTTTCTTGAAGG - Intronic
1107073148 13:36293792-36293814 TCACCTGGATGGTTCTTGATTGG - Intronic
1107999793 13:45895674-45895696 TCTCATGGAAGGTTTTTGAGCGG + Intergenic
1110158608 13:72349030-72349052 TCACCTCAAAATTTTTTGGAAGG + Intergenic
1111381161 13:87454609-87454631 TCACATGTGAGGTCTTTGGAAGG + Intergenic
1112587297 13:100730664-100730686 CCACCTGGAGGGCTTTTGGTTGG + Intergenic
1114683669 14:24507665-24507687 TCACCTGGGAGGTTATGGGTGGG - Intronic
1115977220 14:39010271-39010293 TTACTTAGAAGGTTTTTAGAAGG - Intergenic
1117836541 14:59813286-59813308 TCTCGTGGAAGATTTTTAGATGG - Intronic
1119992441 14:79214236-79214258 TCACCTGGAAGGTTTTCCTCTGG + Intronic
1202864991 14_GL000225v1_random:110974-110996 TCACCTGGATGATTATTGCATGG + Intergenic
1125246826 15:37650278-37650300 TCACCTGGAGGGTCCTTGGGTGG - Intergenic
1126477082 15:49076917-49076939 TCACCTGGAGGGCTTGTGGATGG - Intergenic
1126847103 15:52770459-52770481 TCACCTGGGAGCTTGTTAGATGG - Intronic
1128253982 15:66183793-66183815 TCAGCTGGGAGCTTGTTGGAAGG - Intronic
1129075623 15:72993398-72993420 TCACCTGGGAAGCTTTTGGCAGG - Intergenic
1129271948 15:74423642-74423664 TCACCTGGAAGGTGGGTGGGCGG - Intronic
1138688561 16:58747733-58747755 TCTCCTGGGAGGGTTTGGGAAGG + Intergenic
1139341101 16:66268461-66268483 TCACTTGTAAGGTTGTTGGCAGG - Intergenic
1139386643 16:66576990-66577012 TCAAATGGAAGGTTTTTTAAAGG + Intronic
1139773155 16:69295606-69295628 TCACTTAGAATGCTTTTGGATGG - Intronic
1141850437 16:86641564-86641586 TGACCTGGAAGGTTCCAGGATGG + Intergenic
1146177829 17:30677881-30677903 TTACCTGGAAGGTGATTGCAGGG - Intergenic
1147250650 17:39151111-39151133 TCTCCTGGAAGGATACTGGAGGG - Intronic
1148444512 17:47729352-47729374 GCACCTGGAAGGCTCTTGGATGG - Intergenic
1148850076 17:50550360-50550382 TCACCAGGAAGGCCTTGGGAGGG - Intronic
1149382438 17:56107386-56107408 TAATCTGGATAGTTTTTGGAGGG + Intergenic
1151250077 17:72827597-72827619 ACACCAGGAAGGCTTTGGGAAGG + Intronic
1152231626 17:79116887-79116909 GCACCTGGGAGCTTTTTGGTGGG + Intronic
1153580492 18:6568539-6568561 TCACCTTGCGGGGTTTTGGAGGG - Intronic
1154418186 18:14197381-14197403 GCAGCTGGAAAGTTTTTGCAAGG + Intergenic
1156215686 18:34995907-34995929 TCACCTAGAAGATTTTAGAAAGG + Intronic
1157245085 18:46046535-46046557 TCACTTGGAAGGTGTATAGAAGG - Intronic
1157475609 18:48021604-48021626 TCAGCTGGAAAGTATTTGGGAGG - Intergenic
1157720990 18:49924335-49924357 TCACTTGGTAGGTTGTTGTAAGG - Intronic
1163488446 19:17603326-17603348 TGATCTGGAAGATTTTTGGATGG - Exonic
1167344979 19:48939633-48939655 TCACCTCCATGGTCTTTGGAGGG + Exonic
1167710695 19:51108667-51108689 TCACCCGGCAGGTTGCTGGATGG + Intergenic
925568045 2:5277919-5277941 TCATATGAAAGCTTTTTGGAAGG - Intergenic
926888701 2:17620500-17620522 CCACGTGGAAGGCTTCTGGATGG + Intronic
928605275 2:32940228-32940250 ACACCTGTAAGGTTGTTTGAGGG - Intergenic
930875590 2:56211900-56211922 TGAACTGGGAGGTTTTAGGAAGG - Intronic
931425321 2:62165648-62165670 TTACCTGTATGATTTTTGGATGG - Intergenic
932280046 2:70482956-70482978 TTACCTAGAAGCTTTTGGGAAGG - Intronic
933282538 2:80347728-80347750 TACCCTAGAAGCTTTTTGGAAGG + Intronic
935505433 2:103895539-103895561 TCCCCTGGAATGTTTTATGATGG - Intergenic
936144269 2:109969117-109969139 TCACCTTCAAGGCTTTTGAAAGG - Intergenic
936180951 2:110267077-110267099 TCACCTTCAAGGCTTTTGAAAGG - Intergenic
936200420 2:110402352-110402374 TCACCTTCAAGGCTTTTGAAAGG + Intergenic
937291631 2:120785466-120785488 TCACCTGGGAGGTGTGGGGAGGG + Intronic
940830545 2:158460097-158460119 TTACCTGTATTGTTTTTGGAGGG + Intronic
941425701 2:165341970-165341992 TCATTTGGTAAGTTTTTGGAGGG + Intronic
948175045 2:235936698-235936720 TGACCTGGAAGCTTCTTTGATGG + Intronic
948668311 2:239550246-239550268 TCATCTGGAAGGGTTTTGAAAGG - Intergenic
1170298781 20:14858852-14858874 TCACCTCAAAGGTTGTTGTAAGG + Intronic
1171328280 20:24315290-24315312 TAATCTGGAAGGTTTGTGGATGG + Intergenic
1173006863 20:39146550-39146572 TCACCTGGAGGACTTTTAGAAGG - Intergenic
1173115632 20:40239987-40240009 CTACCTGAAAGGTTTGTGGAGGG - Intergenic
1174965927 20:55214703-55214725 TCACCTGGACCCTTTTTAGATGG - Intergenic
1176855114 21:13961896-13961918 GCAGCTGGAAAGTTTTTGCAAGG - Intergenic
1178754850 21:35338859-35338881 TCACCTGGATGCTTTATGGTAGG - Intronic
1184315911 22:43689146-43689168 TCACCTGCAAGGTTTCTAGCTGG - Intronic
949963198 3:9331837-9331859 TCATTTGGAAGGTTGTTGGCTGG - Intronic
950202242 3:11053079-11053101 TGCCTTGGAAGGTTGTTGGAAGG - Intergenic
950900930 3:16496820-16496842 TCTCCTGGAAGGTGTTTGGGCGG - Intronic
952269045 3:31814637-31814659 TCTCCTTCAAGGTTTCTGGAAGG + Intronic
953894157 3:46782089-46782111 TAACTTGGAAGGATTTTGGTTGG - Intronic
955805411 3:62728917-62728939 TCACCCAGCAGGTTTTTTGAGGG - Intronic
956272031 3:67458126-67458148 TCAGCTGGCAGGTTCTGGGAAGG - Intronic
957587928 3:82156609-82156631 TCAACTGAAAGGTTTTGGCAAGG + Intergenic
959405493 3:105957930-105957952 TCACATGAAAAGTCTTTGGACGG - Intergenic
961698718 3:128725346-128725368 ACAATTGCAAGGTTTTTGGATGG + Intergenic
966302264 3:178492951-178492973 TAACCATGATGGTTTTTGGAAGG - Intronic
967494262 3:190125168-190125190 TCTCCTTTAATGTTTTTGGATGG - Intergenic
977636127 4:99300414-99300436 TCTCTTGGAAGGTTAGTGGAAGG + Intergenic
977638175 4:99324550-99324572 TCTCTTGGAAGGTTAGTGGAAGG + Intergenic
977856215 4:101897562-101897584 TCACCTGGAAGCTTCTTAAAAGG - Intronic
979181179 4:117729423-117729445 TCAACTGAATGGCTTTTGGAAGG + Intergenic
980279284 4:130698538-130698560 TCAGCAAGAATGTTTTTGGAAGG - Intergenic
994652315 5:102543964-102543986 CTACCTGGAATGTTTTTGAAAGG - Intergenic
998427148 5:142038594-142038616 TCACCTTAAAGGTTTGTGCAAGG - Intergenic
1001102503 5:168825712-168825734 TCTTCTGGAAGCTTTCTGGATGG - Intronic
1001985184 5:176068529-176068551 GCAGCTGGAAAGTTTTTGCAAGG + Intronic
1002022377 5:176372051-176372073 TCACCAGGAAGGCTTCTGCATGG - Exonic
1002231682 5:177769606-177769628 GCAGCTGGAAAGTTTTTGCAAGG - Intronic
1002263659 5:178014147-178014169 GCAGCTGGAAAGTTTTTGCAAGG + Intronic
1007469487 6:42079233-42079255 TCAGCTGGAAGGCTGGTGGATGG + Exonic
1011546764 6:88490182-88490204 TCAACAGGATGTTTTTTGGAGGG - Intergenic
1012908021 6:105090199-105090221 TCACCTGGCATGTTTGTGCAAGG + Intergenic
1013515914 6:110885777-110885799 TCACATTAAAGATTTTTGGATGG + Intronic
1013746081 6:113348078-113348100 CCATCTGGAGGATTTTTGGAAGG - Intergenic
1014859275 6:126444763-126444785 TCACATGTAAAGTTTTTGTAAGG - Intergenic
1015244546 6:131062642-131062664 TCAGGAGGAAGGTTTTAGGAGGG - Intronic
1016714633 6:147210632-147210654 GCACCTGGAAGTGTGTTGGAGGG - Intronic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1019633937 7:2065418-2065440 TCATCAGGAATGTTTGTGGACGG + Intronic
1020802774 7:12752105-12752127 CCACCTGGAAGGTTGCTGCAAGG - Intergenic
1023714569 7:43030040-43030062 TCACTTGGAAGCTTTTGGTATGG - Intergenic
1024322744 7:48086957-48086979 TCACCTTGCTGGTTTTTGGCAGG - Intergenic
1028669518 7:93385526-93385548 TCCCATGAAAGGTTTATGGAAGG + Intergenic
1030160684 7:106505497-106505519 TCAGCTGGAAGGCTTAGGGATGG - Intergenic
1031173787 7:118323734-118323756 ATACTTTGAAGGTTTTTGGAGGG + Intergenic
1034059523 7:148073897-148073919 TCATCTGGGAGGGTTCTGGATGG + Intronic
1037492592 8:19410296-19410318 TCAACTGGAAAGATTTTGTAAGG + Intronic
1038671159 8:29584338-29584360 TCAGAGGAAAGGTTTTTGGATGG + Intergenic
1039033902 8:33338270-33338292 TCATCTAGAAGGTTGTTGGGAGG - Intergenic
1041790590 8:61692581-61692603 TCACCTGGAAGGTTTTTGGAGGG - Intronic
1046132649 8:109985979-109986001 TCATCTGGAGGGTTGTGGGAAGG - Intergenic
1048278658 8:133088297-133088319 TCATCAGCAAGGTTTTTGCAAGG - Intronic
1051911439 9:22156613-22156635 TCACCTGGCAGGTAATCGGAGGG - Intergenic
1056052233 9:82781205-82781227 TCACCTGGTCGGTTTCTGAAGGG + Intergenic
1058812405 9:108653537-108653559 TTACCTGGCAGTTTTTTGGGAGG - Intergenic
1060958213 9:127659714-127659736 TCTCCTGGAAGGTTTCTGCCGGG + Intronic
1186104165 X:6187758-6187780 CCACCTTGTAGGATTTTGGAGGG + Intronic
1196866223 X:120073553-120073575 TCAGCTTGAAGCTTTGTGGAAGG + Intronic
1196876874 X:120162728-120162750 TCAGCTTGAAGCTTTGTGGAAGG - Intronic
1200487961 Y:3789822-3789844 AAACATGGAAGGGTTTTGGAGGG + Intergenic
1200967409 Y:9109880-9109902 TCATATGTAGGGTTTTTGGAGGG - Intergenic