ID: 1041791388

View in Genome Browser
Species Human (GRCh38)
Location 8:61699892-61699914
Sequence GTTGAACAGCAGAGGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041791379_1041791388 -2 Left 1041791379 8:61699871-61699893 CCATGGCCCACCCTATGCCTAGT 0: 1
1: 0
2: 0
3: 16
4: 128
Right 1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG No data
1041791374_1041791388 28 Left 1041791374 8:61699841-61699863 CCCAGTGGATGTCCACTCAAGCA 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG No data
1041791373_1041791388 29 Left 1041791373 8:61699840-61699862 CCCCAGTGGATGTCCACTCAAGC 0: 1
1: 0
2: 0
3: 13
4: 101
Right 1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG No data
1041791377_1041791388 16 Left 1041791377 8:61699853-61699875 CCACTCAAGCAACGGACTCCATG 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG No data
1041791380_1041791388 -8 Left 1041791380 8:61699877-61699899 CCCACCCTATGCCTAGTTGAACA 0: 1
1: 0
2: 2
3: 2
4: 69
Right 1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG No data
1041791381_1041791388 -9 Left 1041791381 8:61699878-61699900 CCACCCTATGCCTAGTTGAACAG 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG No data
1041791375_1041791388 27 Left 1041791375 8:61699842-61699864 CCAGTGGATGTCCACTCAAGCAA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041791388 Original CRISPR GTTGAACAGCAGAGGGAACT GGG Intronic
No off target data available for this crispr