ID: 1041792745

View in Genome Browser
Species Human (GRCh38)
Location 8:61714734-61714756
Sequence GCCCTAAGTGAGCAGGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041792745_1041792754 22 Left 1041792745 8:61714734-61714756 CCCCGCCCCTGCTCACTTAGGGC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1041792754 8:61714779-61714801 CTGTGAGCGCGAGCCTCTTTCGG 0: 1
1: 0
2: 0
3: 5
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041792745 Original CRISPR GCCCTAAGTGAGCAGGGGCG GGG (reversed) Intergenic