ID: 1041793447

View in Genome Browser
Species Human (GRCh38)
Location 8:61721957-61721979
Sequence AAGGAGGATTTTCTGTTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041793447_1041793460 25 Left 1041793447 8:61721957-61721979 CCAATCAACAGAAAATCCTCCTT No data
Right 1041793460 8:61722005-61722027 CCAGGGAAAATGCAAGTTGTTGG No data
1041793447_1041793461 26 Left 1041793447 8:61721957-61721979 CCAATCAACAGAAAATCCTCCTT No data
Right 1041793461 8:61722006-61722028 CAGGGAAAATGCAAGTTGTTGGG No data
1041793447_1041793462 27 Left 1041793447 8:61721957-61721979 CCAATCAACAGAAAATCCTCCTT No data
Right 1041793462 8:61722007-61722029 AGGGAAAATGCAAGTTGTTGGGG No data
1041793447_1041793450 -2 Left 1041793447 8:61721957-61721979 CCAATCAACAGAAAATCCTCCTT No data
Right 1041793450 8:61721978-61722000 TTCCTCCTGTCCCCACTCTCAGG No data
1041793447_1041793455 8 Left 1041793447 8:61721957-61721979 CCAATCAACAGAAAATCCTCCTT No data
Right 1041793455 8:61721988-61722010 CCCCACTCTCAGGACTCCCAGGG No data
1041793447_1041793453 7 Left 1041793447 8:61721957-61721979 CCAATCAACAGAAAATCCTCCTT No data
Right 1041793453 8:61721987-61722009 TCCCCACTCTCAGGACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041793447 Original CRISPR AAGGAGGATTTTCTGTTGAT TGG (reversed) Intergenic
No off target data available for this crispr