ID: 1041794627

View in Genome Browser
Species Human (GRCh38)
Location 8:61733901-61733923
Sequence TTGCGTTTTTGTTTCTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041794627_1041794630 0 Left 1041794627 8:61733901-61733923 CCAAAGGAGAAACAAAAACGCAA No data
Right 1041794630 8:61733924-61733946 ACACTGAGGATAGGCATATAAGG No data
1041794627_1041794633 26 Left 1041794627 8:61733901-61733923 CCAAAGGAGAAACAAAAACGCAA No data
Right 1041794633 8:61733950-61733972 CTACTAGTTGGTGATGAGCTGGG No data
1041794627_1041794629 -9 Left 1041794627 8:61733901-61733923 CCAAAGGAGAAACAAAAACGCAA No data
Right 1041794629 8:61733915-61733937 AAAACGCAAACACTGAGGATAGG No data
1041794627_1041794632 25 Left 1041794627 8:61733901-61733923 CCAAAGGAGAAACAAAAACGCAA No data
Right 1041794632 8:61733949-61733971 TCTACTAGTTGGTGATGAGCTGG No data
1041794627_1041794631 14 Left 1041794627 8:61733901-61733923 CCAAAGGAGAAACAAAAACGCAA No data
Right 1041794631 8:61733938-61733960 CATATAAGGATTCTACTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041794627 Original CRISPR TTGCGTTTTTGTTTCTCCTT TGG (reversed) Intergenic
No off target data available for this crispr