ID: 1041794632

View in Genome Browser
Species Human (GRCh38)
Location 8:61733949-61733971
Sequence TCTACTAGTTGGTGATGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041794626_1041794632 26 Left 1041794626 8:61733900-61733922 CCCAAAGGAGAAACAAAAACGCA No data
Right 1041794632 8:61733949-61733971 TCTACTAGTTGGTGATGAGCTGG No data
1041794627_1041794632 25 Left 1041794627 8:61733901-61733923 CCAAAGGAGAAACAAAAACGCAA No data
Right 1041794632 8:61733949-61733971 TCTACTAGTTGGTGATGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041794632 Original CRISPR TCTACTAGTTGGTGATGAGC TGG Intergenic
No off target data available for this crispr