ID: 1041796893

View in Genome Browser
Species Human (GRCh38)
Location 8:61754345-61754367
Sequence CAGAGAGGAAAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041796893_1041796903 28 Left 1041796893 8:61754345-61754367 CCCTCCTCCCTCTTTCCTCTCTG No data
Right 1041796903 8:61754396-61754418 GTACTGTAACATGTTTTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041796893 Original CRISPR CAGAGAGGAAAGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr