ID: 1041796903

View in Genome Browser
Species Human (GRCh38)
Location 8:61754396-61754418
Sequence GTACTGTAACATGTTTTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041796897_1041796903 20 Left 1041796897 8:61754353-61754375 CCTCTTTCCTCTCTGCCCCCTTT No data
Right 1041796903 8:61754396-61754418 GTACTGTAACATGTTTTGATAGG No data
1041796895_1041796903 24 Left 1041796895 8:61754349-61754371 CCTCCCTCTTTCCTCTCTGCCCC No data
Right 1041796903 8:61754396-61754418 GTACTGTAACATGTTTTGATAGG No data
1041796901_1041796903 3 Left 1041796901 8:61754370-61754392 CCCTTTCTTTTTTTTTATTCTAC No data
Right 1041796903 8:61754396-61754418 GTACTGTAACATGTTTTGATAGG No data
1041796899_1041796903 5 Left 1041796899 8:61754368-61754390 CCCCCTTTCTTTTTTTTTATTCT No data
Right 1041796903 8:61754396-61754418 GTACTGTAACATGTTTTGATAGG No data
1041796892_1041796903 29 Left 1041796892 8:61754344-61754366 CCCCTCCTCCCTCTTTCCTCTCT No data
Right 1041796903 8:61754396-61754418 GTACTGTAACATGTTTTGATAGG No data
1041796893_1041796903 28 Left 1041796893 8:61754345-61754367 CCCTCCTCCCTCTTTCCTCTCTG No data
Right 1041796903 8:61754396-61754418 GTACTGTAACATGTTTTGATAGG No data
1041796900_1041796903 4 Left 1041796900 8:61754369-61754391 CCCCTTTCTTTTTTTTTATTCTA No data
Right 1041796903 8:61754396-61754418 GTACTGTAACATGTTTTGATAGG No data
1041796896_1041796903 21 Left 1041796896 8:61754352-61754374 CCCTCTTTCCTCTCTGCCCCCTT No data
Right 1041796903 8:61754396-61754418 GTACTGTAACATGTTTTGATAGG No data
1041796898_1041796903 13 Left 1041796898 8:61754360-61754382 CCTCTCTGCCCCCTTTCTTTTTT No data
Right 1041796903 8:61754396-61754418 GTACTGTAACATGTTTTGATAGG No data
1041796902_1041796903 2 Left 1041796902 8:61754371-61754393 CCTTTCTTTTTTTTTATTCTACA No data
Right 1041796903 8:61754396-61754418 GTACTGTAACATGTTTTGATAGG No data
1041796894_1041796903 27 Left 1041796894 8:61754346-61754368 CCTCCTCCCTCTTTCCTCTCTGC No data
Right 1041796903 8:61754396-61754418 GTACTGTAACATGTTTTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041796903 Original CRISPR GTACTGTAACATGTTTTGAT AGG Intergenic
No off target data available for this crispr