ID: 1041799340

View in Genome Browser
Species Human (GRCh38)
Location 8:61782083-61782105
Sequence AAGGAAACTTTGGAGGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041799340_1041799347 14 Left 1041799340 8:61782083-61782105 CCTATCACCTCCAAAGTTTCCTT No data
Right 1041799347 8:61782120-61782142 GCAATGACTAATTTCTTGCCAGG No data
1041799340_1041799345 -8 Left 1041799340 8:61782083-61782105 CCTATCACCTCCAAAGTTTCCTT No data
Right 1041799345 8:61782098-61782120 GTTTCCTTGGGTCTCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041799340 Original CRISPR AAGGAAACTTTGGAGGTGAT AGG (reversed) Intergenic
No off target data available for this crispr