ID: 1041803447

View in Genome Browser
Species Human (GRCh38)
Location 8:61824370-61824392
Sequence TTGATAAATTACCCAATCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041803447_1041803456 28 Left 1041803447 8:61824370-61824392 CCCAAGATTGGGTAATTTATCAA No data
Right 1041803456 8:61824421-61824443 CCCAGGACTGGGGAGGCCTCAGG No data
1041803447_1041803453 21 Left 1041803447 8:61824370-61824392 CCCAAGATTGGGTAATTTATCAA No data
Right 1041803453 8:61824414-61824436 ACAGTTCCCCAGGACTGGGGAGG No data
1041803447_1041803452 18 Left 1041803447 8:61824370-61824392 CCCAAGATTGGGTAATTTATCAA No data
Right 1041803452 8:61824411-61824433 CTCACAGTTCCCCAGGACTGGGG No data
1041803447_1041803449 11 Left 1041803447 8:61824370-61824392 CCCAAGATTGGGTAATTTATCAA No data
Right 1041803449 8:61824404-61824426 TAATTTACTCACAGTTCCCCAGG No data
1041803447_1041803451 17 Left 1041803447 8:61824370-61824392 CCCAAGATTGGGTAATTTATCAA No data
Right 1041803451 8:61824410-61824432 ACTCACAGTTCCCCAGGACTGGG No data
1041803447_1041803450 16 Left 1041803447 8:61824370-61824392 CCCAAGATTGGGTAATTTATCAA No data
Right 1041803450 8:61824409-61824431 TACTCACAGTTCCCCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041803447 Original CRISPR TTGATAAATTACCCAATCTT GGG (reversed) Intergenic
No off target data available for this crispr