ID: 1041803450

View in Genome Browser
Species Human (GRCh38)
Location 8:61824409-61824431
Sequence TACTCACAGTTCCCCAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041803448_1041803450 15 Left 1041803448 8:61824371-61824393 CCAAGATTGGGTAATTTATCAAT No data
Right 1041803450 8:61824409-61824431 TACTCACAGTTCCCCAGGACTGG No data
1041803447_1041803450 16 Left 1041803447 8:61824370-61824392 CCCAAGATTGGGTAATTTATCAA No data
Right 1041803450 8:61824409-61824431 TACTCACAGTTCCCCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041803450 Original CRISPR TACTCACAGTTCCCCAGGAC TGG Intergenic
No off target data available for this crispr