ID: 1041806509

View in Genome Browser
Species Human (GRCh38)
Location 8:61855398-61855420
Sequence ATGTTATTATTTTTGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041806506_1041806509 -4 Left 1041806506 8:61855379-61855401 CCTGGCCATATTTTAGTTTATGT No data
Right 1041806509 8:61855398-61855420 ATGTTATTATTTTTGAAACAGGG No data
1041806505_1041806509 4 Left 1041806505 8:61855371-61855393 CCACTGTGCCTGGCCATATTTTA No data
Right 1041806509 8:61855398-61855420 ATGTTATTATTTTTGAAACAGGG No data
1041806507_1041806509 -9 Left 1041806507 8:61855384-61855406 CCATATTTTAGTTTATGTTATTA No data
Right 1041806509 8:61855398-61855420 ATGTTATTATTTTTGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041806509 Original CRISPR ATGTTATTATTTTTGAAACA GGG Intergenic
No off target data available for this crispr