ID: 1041808974

View in Genome Browser
Species Human (GRCh38)
Location 8:61886912-61886934
Sequence GTGTCTGGAGTCACTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041808967_1041808974 1 Left 1041808967 8:61886888-61886910 CCTAGGATTTTAGGTTCTTGCCT No data
Right 1041808974 8:61886912-61886934 GTGTCTGGAGTCACTGGGGTTGG No data
1041808964_1041808974 21 Left 1041808964 8:61886868-61886890 CCAAATGGACTGGTCTCTAACCT No data
Right 1041808974 8:61886912-61886934 GTGTCTGGAGTCACTGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041808974 Original CRISPR GTGTCTGGAGTCACTGGGGT TGG Intergenic
No off target data available for this crispr