ID: 1041810947

View in Genome Browser
Species Human (GRCh38)
Location 8:61909749-61909771
Sequence GATAGCATGACTAACACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041810947_1041810949 6 Left 1041810947 8:61909749-61909771 CCTGCAGTGTTAGTCATGCTATC No data
Right 1041810949 8:61909778-61909800 TTCTCATGTGTGTCTTTTGAGGG No data
1041810947_1041810948 5 Left 1041810947 8:61909749-61909771 CCTGCAGTGTTAGTCATGCTATC No data
Right 1041810948 8:61909777-61909799 TTTCTCATGTGTGTCTTTTGAGG No data
1041810947_1041810950 15 Left 1041810947 8:61909749-61909771 CCTGCAGTGTTAGTCATGCTATC No data
Right 1041810950 8:61909787-61909809 GTGTCTTTTGAGGGTTTCTTAGG No data
1041810947_1041810951 26 Left 1041810947 8:61909749-61909771 CCTGCAGTGTTAGTCATGCTATC No data
Right 1041810951 8:61909798-61909820 GGGTTTCTTAGGTCTTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041810947 Original CRISPR GATAGCATGACTAACACTGC AGG (reversed) Intergenic
No off target data available for this crispr