ID: 1041812645

View in Genome Browser
Species Human (GRCh38)
Location 8:61928454-61928476
Sequence CTGCTTCCACAAGTGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041812645_1041812649 1 Left 1041812645 8:61928454-61928476 CCTTTCACCACTTGTGGAAGCAG No data
Right 1041812649 8:61928478-61928500 CTGAGGGCTTCATCAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041812645 Original CRISPR CTGCTTCCACAAGTGGTGAA AGG (reversed) Intergenic
No off target data available for this crispr