ID: 1041823128

View in Genome Browser
Species Human (GRCh38)
Location 8:62062541-62062563
Sequence TGCTCCACCTCTGAGATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823128_1041823132 15 Left 1041823128 8:62062541-62062563 CCCTAGATCTCAGAGGTGGAGCA No data
Right 1041823132 8:62062579-62062601 CCACCAATCATCCCCCTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823128 Original CRISPR TGCTCCACCTCTGAGATCTA GGG (reversed) Intergenic
No off target data available for this crispr