ID: 1041823797

View in Genome Browser
Species Human (GRCh38)
Location 8:62068616-62068638
Sequence CCACTCCCGGCAGCTGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823797_1041823809 24 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823809 8:62068663-62068685 GGCAGAGCTACCCAAGGCCATGG No data
1041823797_1041823808 18 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823808 8:62068657-62068679 CACAGGGGCAGAGCTACCCAAGG No data
1041823797_1041823810 25 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823810 8:62068664-62068686 GCAGAGCTACCCAAGGCCATGGG No data
1041823797_1041823804 2 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823804 8:62068641-62068663 CTGTACCCTGCAAAGTCACAGGG 0: 58
1: 1008
2: 1533
3: 1330
4: 1060
1041823797_1041823805 3 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823805 8:62068642-62068664 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011
1041823797_1041823803 1 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823803 8:62068640-62068662 GCTGTACCCTGCAAAGTCACAGG 0: 57
1: 963
2: 1540
3: 1484
4: 1213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823797 Original CRISPR CCACTCCCGGCAGCTGTCAT GGG (reversed) Intergenic
No off target data available for this crispr