ID: 1041823797

View in Genome Browser
Species Human (GRCh38)
Location 8:62068616-62068638
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823797_1041823808 18 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823808 8:62068657-62068679 CACAGGGGCAGAGCTACCCAAGG No data
1041823797_1041823804 2 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823804 8:62068641-62068663 CTGTACCCTGCAAAGTCACAGGG No data
1041823797_1041823809 24 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823809 8:62068663-62068685 GGCAGAGCTACCCAAGGCCATGG No data
1041823797_1041823805 3 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823805 8:62068642-62068664 TGTACCCTGCAAAGTCACAGGGG No data
1041823797_1041823810 25 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823810 8:62068664-62068686 GCAGAGCTACCCAAGGCCATGGG No data
1041823797_1041823803 1 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823803 8:62068640-62068662 GCTGTACCCTGCAAAGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823797 Original CRISPR CCACTCCCGGCAGCTGTCAT GGG (reversed) Intergenic