ID: 1041823802

View in Genome Browser
Species Human (GRCh38)
Location 8:62068629-62068651
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823802_1041823810 12 Left 1041823802 8:62068629-62068651 CCGGGAGTGGGGCTGTACCCTGC No data
Right 1041823810 8:62068664-62068686 GCAGAGCTACCCAAGGCCATGGG No data
1041823802_1041823808 5 Left 1041823802 8:62068629-62068651 CCGGGAGTGGGGCTGTACCCTGC No data
Right 1041823808 8:62068657-62068679 CACAGGGGCAGAGCTACCCAAGG No data
1041823802_1041823809 11 Left 1041823802 8:62068629-62068651 CCGGGAGTGGGGCTGTACCCTGC No data
Right 1041823809 8:62068663-62068685 GGCAGAGCTACCCAAGGCCATGG No data
1041823802_1041823805 -10 Left 1041823802 8:62068629-62068651 CCGGGAGTGGGGCTGTACCCTGC No data
Right 1041823805 8:62068642-62068664 TGTACCCTGCAAAGTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823802 Original CRISPR GCAGGGTACAGCCCCACTCC CGG (reversed) Intergenic