ID: 1041823803

View in Genome Browser
Species Human (GRCh38)
Location 8:62068640-62068662
Sequence GCTGTACCCTGCAAAGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5257
Summary {0: 57, 1: 963, 2: 1540, 3: 1484, 4: 1213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823797_1041823803 1 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823803 8:62068640-62068662 GCTGTACCCTGCAAAGTCACAGG 0: 57
1: 963
2: 1540
3: 1484
4: 1213
1041823799_1041823803 0 Left 1041823799 8:62068617-62068639 CCATGACAGCTGCCGGGAGTGGG No data
Right 1041823803 8:62068640-62068662 GCTGTACCCTGCAAAGTCACAGG 0: 57
1: 963
2: 1540
3: 1484
4: 1213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823803 Original CRISPR GCTGTACCCTGCAAAGTCAC AGG Intergenic
Too many off-targets to display for this crispr