ID: 1041823804

View in Genome Browser
Species Human (GRCh38)
Location 8:62068641-62068663
Sequence CTGTACCCTGCAAAGTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4989
Summary {0: 58, 1: 1008, 2: 1533, 3: 1330, 4: 1060}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823799_1041823804 1 Left 1041823799 8:62068617-62068639 CCATGACAGCTGCCGGGAGTGGG No data
Right 1041823804 8:62068641-62068663 CTGTACCCTGCAAAGTCACAGGG 0: 58
1: 1008
2: 1533
3: 1330
4: 1060
1041823797_1041823804 2 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823804 8:62068641-62068663 CTGTACCCTGCAAAGTCACAGGG 0: 58
1: 1008
2: 1533
3: 1330
4: 1060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823804 Original CRISPR CTGTACCCTGCAAAGTCACA GGG Intergenic
Too many off-targets to display for this crispr