ID: 1041823805

View in Genome Browser
Species Human (GRCh38)
Location 8:62068642-62068664
Sequence TGTACCCTGCAAAGTCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4867
Summary {0: 57, 1: 1030, 2: 1415, 3: 1354, 4: 1011}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823802_1041823805 -10 Left 1041823802 8:62068629-62068651 CCGGGAGTGGGGCTGTACCCTGC 0: 29
1: 117
2: 610
3: 878
4: 896
Right 1041823805 8:62068642-62068664 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011
1041823799_1041823805 2 Left 1041823799 8:62068617-62068639 CCATGACAGCTGCCGGGAGTGGG No data
Right 1041823805 8:62068642-62068664 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011
1041823797_1041823805 3 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823805 8:62068642-62068664 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823805 Original CRISPR TGTACCCTGCAAAGTCACAG GGG Intergenic
Too many off-targets to display for this crispr