ID: 1041823806

View in Genome Browser
Species Human (GRCh38)
Location 8:62068646-62068668
Sequence TCTGCCCCTGTGACTTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4754
Summary {0: 30, 1: 550, 2: 995, 3: 1542, 4: 1637}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823806_1041823815 24 Left 1041823806 8:62068646-62068668 CCCTGCAAAGTCACAGGGGCAGA 0: 30
1: 550
2: 995
3: 1542
4: 1637
Right 1041823815 8:62068693-62068715 TCTCTTGCATCAGCATGACCTGG 0: 45
1: 606
2: 971
3: 1302
4: 1416
1041823806_1041823809 -6 Left 1041823806 8:62068646-62068668 CCCTGCAAAGTCACAGGGGCAGA 0: 30
1: 550
2: 995
3: 1542
4: 1637
Right 1041823809 8:62068663-62068685 GGCAGAGCTACCCAAGGCCATGG No data
1041823806_1041823810 -5 Left 1041823806 8:62068646-62068668 CCCTGCAAAGTCACAGGGGCAGA 0: 30
1: 550
2: 995
3: 1542
4: 1637
Right 1041823810 8:62068664-62068686 GCAGAGCTACCCAAGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823806 Original CRISPR TCTGCCCCTGTGACTTTGCA GGG (reversed) Intergenic
Too many off-targets to display for this crispr