ID: 1041823807

View in Genome Browser
Species Human (GRCh38)
Location 8:62068647-62068669
Sequence CTCTGCCCCTGTGACTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5053
Summary {0: 23, 1: 569, 2: 1002, 3: 1597, 4: 1862}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823807_1041823815 23 Left 1041823807 8:62068647-62068669 CCTGCAAAGTCACAGGGGCAGAG 0: 23
1: 569
2: 1002
3: 1597
4: 1862
Right 1041823815 8:62068693-62068715 TCTCTTGCATCAGCATGACCTGG 0: 45
1: 606
2: 971
3: 1302
4: 1416
1041823807_1041823810 -6 Left 1041823807 8:62068647-62068669 CCTGCAAAGTCACAGGGGCAGAG 0: 23
1: 569
2: 1002
3: 1597
4: 1862
Right 1041823810 8:62068664-62068686 GCAGAGCTACCCAAGGCCATGGG No data
1041823807_1041823809 -7 Left 1041823807 8:62068647-62068669 CCTGCAAAGTCACAGGGGCAGAG 0: 23
1: 569
2: 1002
3: 1597
4: 1862
Right 1041823809 8:62068663-62068685 GGCAGAGCTACCCAAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823807 Original CRISPR CTCTGCCCCTGTGACTTTGC AGG (reversed) Intergenic
Too many off-targets to display for this crispr