ID: 1041823808

View in Genome Browser
Species Human (GRCh38)
Location 8:62068657-62068679
Sequence CACAGGGGCAGAGCTACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823797_1041823808 18 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823808 8:62068657-62068679 CACAGGGGCAGAGCTACCCAAGG No data
1041823799_1041823808 17 Left 1041823799 8:62068617-62068639 CCATGACAGCTGCCGGGAGTGGG No data
Right 1041823808 8:62068657-62068679 CACAGGGGCAGAGCTACCCAAGG No data
1041823802_1041823808 5 Left 1041823802 8:62068629-62068651 CCGGGAGTGGGGCTGTACCCTGC 0: 29
1: 117
2: 610
3: 878
4: 896
Right 1041823808 8:62068657-62068679 CACAGGGGCAGAGCTACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823808 Original CRISPR CACAGGGGCAGAGCTACCCA AGG Intergenic
No off target data available for this crispr