ID: 1041823810

View in Genome Browser
Species Human (GRCh38)
Location 8:62068664-62068686
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823806_1041823810 -5 Left 1041823806 8:62068646-62068668 CCCTGCAAAGTCACAGGGGCAGA No data
Right 1041823810 8:62068664-62068686 GCAGAGCTACCCAAGGCCATGGG No data
1041823797_1041823810 25 Left 1041823797 8:62068616-62068638 CCCATGACAGCTGCCGGGAGTGG No data
Right 1041823810 8:62068664-62068686 GCAGAGCTACCCAAGGCCATGGG No data
1041823807_1041823810 -6 Left 1041823807 8:62068647-62068669 CCTGCAAAGTCACAGGGGCAGAG No data
Right 1041823810 8:62068664-62068686 GCAGAGCTACCCAAGGCCATGGG No data
1041823802_1041823810 12 Left 1041823802 8:62068629-62068651 CCGGGAGTGGGGCTGTACCCTGC No data
Right 1041823810 8:62068664-62068686 GCAGAGCTACCCAAGGCCATGGG No data
1041823799_1041823810 24 Left 1041823799 8:62068617-62068639 CCATGACAGCTGCCGGGAGTGGG No data
Right 1041823810 8:62068664-62068686 GCAGAGCTACCCAAGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823810 Original CRISPR GCAGAGCTACCCAAGGCCAT GGG Intergenic