ID: 1041823815

View in Genome Browser
Species Human (GRCh38)
Location 8:62068693-62068715
Sequence TCTCTTGCATCAGCATGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823807_1041823815 23 Left 1041823807 8:62068647-62068669 CCTGCAAAGTCACAGGGGCAGAG No data
Right 1041823815 8:62068693-62068715 TCTCTTGCATCAGCATGACCTGG No data
1041823806_1041823815 24 Left 1041823806 8:62068646-62068668 CCCTGCAAAGTCACAGGGGCAGA No data
Right 1041823815 8:62068693-62068715 TCTCTTGCATCAGCATGACCTGG No data
1041823811_1041823815 -3 Left 1041823811 8:62068673-62068695 CCCAAGGCCATGGGAGTCCATCT No data
Right 1041823815 8:62068693-62068715 TCTCTTGCATCAGCATGACCTGG No data
1041823813_1041823815 -10 Left 1041823813 8:62068680-62068702 CCATGGGAGTCCATCTCTTGCAT No data
Right 1041823815 8:62068693-62068715 TCTCTTGCATCAGCATGACCTGG No data
1041823812_1041823815 -4 Left 1041823812 8:62068674-62068696 CCAAGGCCATGGGAGTCCATCTC No data
Right 1041823815 8:62068693-62068715 TCTCTTGCATCAGCATGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823815 Original CRISPR TCTCTTGCATCAGCATGACC TGG Intergenic