ID: 1041823902

View in Genome Browser
Species Human (GRCh38)
Location 8:62069339-62069361
Sequence AGGACAGAGGTCAGTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823902_1041823907 0 Left 1041823902 8:62069339-62069361 CCCAGAGGACTGACCTCTGTCCT No data
Right 1041823907 8:62069362-62069384 CCCAGTGTTAAATCTCAGACAGG No data
1041823902_1041823911 24 Left 1041823902 8:62069339-62069361 CCCAGAGGACTGACCTCTGTCCT No data
Right 1041823911 8:62069386-62069408 GTATCCAGCTTGGAGGAGAATGG 0: 1
1: 0
2: 0
3: 25
4: 166
1041823902_1041823910 17 Left 1041823902 8:62069339-62069361 CCCAGAGGACTGACCTCTGTCCT No data
Right 1041823910 8:62069379-62069401 GACAGGTGTATCCAGCTTGGAGG No data
1041823902_1041823909 14 Left 1041823902 8:62069339-62069361 CCCAGAGGACTGACCTCTGTCCT No data
Right 1041823909 8:62069376-62069398 TCAGACAGGTGTATCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823902 Original CRISPR AGGACAGAGGTCAGTCCTCT GGG (reversed) Intergenic