ID: 1041823907

View in Genome Browser
Species Human (GRCh38)
Location 8:62069362-62069384
Sequence CCCAGTGTTAAATCTCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823901_1041823907 13 Left 1041823901 8:62069326-62069348 CCTAACGGGGCTTCCCAGAGGAC No data
Right 1041823907 8:62069362-62069384 CCCAGTGTTAAATCTCAGACAGG No data
1041823898_1041823907 23 Left 1041823898 8:62069316-62069338 CCCTGACTTTCCTAACGGGGCTT No data
Right 1041823907 8:62069362-62069384 CCCAGTGTTAAATCTCAGACAGG No data
1041823903_1041823907 -1 Left 1041823903 8:62069340-62069362 CCAGAGGACTGACCTCTGTCCTC No data
Right 1041823907 8:62069362-62069384 CCCAGTGTTAAATCTCAGACAGG No data
1041823902_1041823907 0 Left 1041823902 8:62069339-62069361 CCCAGAGGACTGACCTCTGTCCT No data
Right 1041823907 8:62069362-62069384 CCCAGTGTTAAATCTCAGACAGG No data
1041823899_1041823907 22 Left 1041823899 8:62069317-62069339 CCTGACTTTCCTAACGGGGCTTC No data
Right 1041823907 8:62069362-62069384 CCCAGTGTTAAATCTCAGACAGG No data
1041823894_1041823907 29 Left 1041823894 8:62069310-62069332 CCAGTGCCCTGACTTTCCTAACG No data
Right 1041823907 8:62069362-62069384 CCCAGTGTTAAATCTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823907 Original CRISPR CCCAGTGTTAAATCTCAGAC AGG Intergenic